Description :
From Genome Similarity Track
Location :
Scaffold_13:9771- 11326
Transcript NameFunction/comments
Phyke_g913hypothetical protein PHYSODRAFT_342126

Sequence
1555 bases(100 bases per row)
CtactcgtccttcttgttcagaTAACTGGATTCGTCAGCGGGCCACAGTGCCCCCCAATGCGCTTTGCGAGATGCACGATACACCTCACGAACGGCCTTG
CCCCTAGTAACACTACGACGATCCAGCTTACCCTGTCGTAACAAACCACGACACATCTTGTTAGACCGATGCATCAGTAGAACAGAGTGGCCAGCCAAAT
CCACGTACCTCTGGGGTGCACAGATCAAGATGAACATGGCGCGTAGCGAGCAGTGGTCCTCGGAGCATACGGGCTAAcggctgcttcttgctcacaGCAT
TGTCCTCCTCGCTGCCCTTGCTGGTCTTCTGCATGATAGCGTATGAAAACTTGGACCCCTTCTGTCCGTGCCAGCGCTTCGTAGTGGCCTCTCGGGGTTT
GTTCACGACAGGAGAGCGTTGAACAAAGTGGCACCACGtgcttccagctgctgggCACTGAATATTCACACATACATATGTGGGTAAGCGAACCAAAACA
AGATACGAGGGCTAATAAGGCGAATACAAACCTCAAAGTGATGCGGGCACGGTGCGACGATGAGAACTCCTTCTTtagcatcttcatcttcagccacCGA
GTCCAGCACGAACTGACGTGCTGAGCGCACGTTATGTGATCCCCACGGACTCCCCTTGTCTACGACAACAAGACATCCGTTCTCATTCAGCAACTCCCAG
AGCGCCGAGGTGGTCGCCACACGTTCAAAGTCGTTGGTAATATCCGAGAACACGAAGCTAACGACAACGAGATCATACTTGTTTCCGGCATCGATATCTC
TTGTCAAGTCAGCAATGCTGCGACGCACACTAAGGCCAGGGAAGCCTTCCAACAGtacttcagcagcatccaccatCGATTGACTGGGCTCTACCACTCG
GTATTTGTCCACTGTCTCTCCATAGAATTCTTTGGCCACCCAGGAGCTCGTTCCAGGTCCAGCACCAAAGTCCAGCACCGATTTAGGCTTGAACTCAGGA
AgacgcttctgcagctccgagaAGACGGCGTGGGTACTGGCGTACGTGCCTTCCATCTCAAAGGCCAAGTAGGCGAGCGTCTCCGACGGCCCGTAAGAGA
ATGGAGGAATCTGTTGGCTCTTGTCCATCGTCCAGCCCAGCGGCTTCTTGCTCATATCCAGCGGCAGTTTGCGCGTGTTCTGAGGGTCGCCAACGTGCTT
CTGACGCAGCGTCTCGAGCTGAGAATGCGTACGATTGCGCACTACAGATGTCAGACGGTCTAGCAAATCTGTGGGCATCTCGACACGCTGCGCCAGACCG
TTACGTGAGAGCTGGTTGATGTCCGAGAGGATGGAAGAGGTCTGAGGGTGGGGAGATGCCACAGACTCGGCACTACCTGTGGCTCTACGCAGACGACGAG
CACGGCGATTGGCGGCAGGAGAAGCGAAGGAGGCGGAGAACATCGGAGGAGAGATAACAGGCACGAAGCGCaagctggaagctgcagagagCCCGCGAAC
GCGAAGCGTCTGGAGCATCATGGCGGCCTGagtgttgtggtggtggtggccagca