Description :
From Genome Similarity Track
Location :
Scaffold_71:9771- 21917
Sequence
12146 bases(100 bases per row)
CCTTGCCCGTGAACTCCTTCAGATCCGATATGGCTGAGATCCGTACCCTCTGGATCATGGACGATCCACCTGCCCCGGCTGTGGCTGTTGCTACCACTGC
TGACGAAGTGGATGGGCCATCCAGATCATCTGGGTCGAACTCATCATGGGAGTTGTCTCCCTCCACGGACTCCATCTCCACGTCTCGTGCTCCATGTTCG
TGGAGCACTTGCACTTGTAGCACGGGCGCTCTCATACCCTGTTCGGCCAGGAAACGACCCATCGCAGCTTCGAAGTGTCGCTGCAGGGTGCCCGAGGAAG
TGTCGGAAGAGCCTGTGGCCGTCTGGCCCACTGGCGAGACCGGATCCGTGAGGCGATTACCTTGAGCCCGATCTGACGATAGTCCCACTGGCTTCTTGCC
GGATCTGGCTTGATCCTGGTTCGATTGTATCAGATCACGGGTAGGGCGTACTGGATCCCAAGTCTTCACGCTCAAAGGCACTTCCTGTCCCCGGATCCTC
GCCCGCGCTTCCAGCATGGATGCCCCGGAGGGGCCTTAGGTCATGCGTCGCGGCTCCGAAGACCTATCTGACCCATCCTCAGCCGCGGATTCGTAGTTAG
AGGATGCAGCTTGGCTGATCCTCGGCGACGACACTGGATCCATAGTGCGCGACCTTTCTCCGGTGATGGACTTAACTCTGGCAAAGAGGTCCCGCGTCGC
GGATACTATGAGATCCAGGTCTAGCTCGAAGATATCCTCTGCGTCGAACACACCAGCTACGATGCCTGACTCCGTAAGCAAACGTAATAGATCCTTGACT
GCCACCAACTTGTTCGCCGTTTTCGTTGGTGCTCTCACCGGTTCTCTTGGATCTTCGATCTGTCGTGGATTCAGGATCTGCATGACAGGATCTTGATGCA
GGAAGTCGCGTAAAGCTTGATGGCGATACACAAACTCGAGATCCTTGTCTGACCAGCCTGACCTGGATCCAGCTTGGTCTTCTTCCGACTCTGGAGCTTG
CATCTTCTTCCGCGTAGTATTACTCGTTTTCGTCTTCTTTCTCGTTTCTTCGACTAGCGGGGTTAGGTTTAGGTAAGGTGTTGGCTTAANNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCCCTGATGTTGAGAACTTCATTGCAGTGATGCGACACATTTGTGCCTTCAGACATATCC
ATGCTGAAGAGCTTTGTTTTAGGTAAATACGACCAGCCCTTCTGCGATTCTCCGTACAACGCCTTCAAGCGCGCCCACGCGGTCCACGCTTCCTCGTAGC
TGTCGACCACGTGGTGGTAGTCCGCGTCCATAGGGAGCAGCATCAATCCGAACGCGATGTTGCTCGACTTGACGTACTCGTCCTTCGCACGAGGGTGTCC
GTGAAGCTGGGAGTCGTCTCTCGGTTCATGACATGCCATACCGACTTGGTCAGGAGCACACCACGCATGTAGCGTCTTCACGTCGCGTAGCTATCACTGT
TGAACTTGTCGATGGAGACCTTAGTTGAAACGTCTTTCGCGAAGGACATGGTACTTGGGCTCATATCCTCATAGAGGTCACGGGTCTTGTGCAACGTTAA
GCTTGTACGGAGCGAAGGGAAGAGTCGCCACTTGGGGAGAAGATCGGAGTGAAGACACTTGAGTGAAAGAAGGAAGATTCGAAAGTGATTGATTTATCGC
GGCCTCACTACCTAGGTCATCCAATCATTTGGTGCATCCAATTACCAGCACTCTGCACTCGTTCGATCATCCTACTCGTCTAACCATCGGTAGCGTAATC
AATGTACCGTAATCATCGCGGGGTTGTGTTGGACAGGTTCGGGCTACCGCTATTTGGGTACTTACCGTCTGAAACCGGAATCCCTCAAAATGTATATCCA
GTGTTATCGATAAACCTGTATGAAAACATACTTTGGGTAAGATCGAAATAACTTTATACTTACAGCTGGCAACAATTGTACGTAAAACGGTCGTAACACG
TAATGAAAATGCGAAACTTTTTTCTCAGAATGACCCAGTCGGACAAAAACGACATTCGAACAGCCTTCTAGCTGTGGTGTTGGAATTCCCACGTGAACTC
TAGCTACGAATGTAGTTAGGACGTTCCCACAACAATACGTCTACTAGGATAGTAAACGATCGTTCGGGCGGACCTGAAGACCCCAGTTCTGCCCTTGCAC
CGGGACAAAGTGGATCTTGTAAACTACTTATATAGGCCAACCAGTAAAAATAGGAGCACGCTACTAGCACGAGCAAAGTTAGCAGGTGTTTTGAATCCTT
GTGGTCCCAACAGCGGAAGGGTACCAGGCACGAGTAAGCCTTTTACGAGATCACCGAGTGCTCAACACTCGGTAGGAAGAATAAAAGGGAGGCAATTCAA
GCACTCCCAGTCGTGCAAATAGGCAACAATAAGCCGTCACGTAAAACCTCCCGATAATAATCGGCCAATACACAAAGTCTCTTGGCCTTGCCGGATGAAC
CCTCGCTACAGAGCTTCGAGTTCACCGACAGGCATAACACACTCAAACAAGCTTGACCAGACGCTTACCTTGAAGCCGGACGTCGCTCTGTGTGCTTGAG
TGGAAATTCTGTTCTGTATTTAAGCTTACCCTTTCGGGTCTATTCCTAATAAGAAGTCCTAATCAAGTATACAAATATCAAGTGAAAAAGGATCCGTTAT
GGATCTTCTTGCATGCCAAGCGTCGTCTGCACTGTCGCATGAGCATCTTTAACGGTCCGCGCCCTGTCCCAGACGGTTAACGTGTCTTCCAAAGGTCGCT
GAGTATTCCGCGAACTCATCCCAACCGCCACTGAGGGTTCGTACCGTAGATGGTCCGCTGAATGCGAATCCGGCCAGTCCATTATTAATAATAAAGACAG
ACTGGATTCAGTGACATATGCCCGTATCCAATACTCGTTGAACGTTCGGAGGTGACGCCGTCGAGTCCCTTGCACCTTGGCGTCTCCGTACATCAAATGA
CCAAGGGCTCGTTGCTTAAACATCTTGGGCGGTGTCACGTCTTTGTCGACGGGTGATAATCCGCAACTACGGAAAAATCACTACACCACAACTGCCCCTG
TCGCAATGGAAGCCACGGTACTGGTGCCCGTTGTGACATTTCTTCATTCTTCAATTCACCATCTCGCCACCGTATGTCCAAGCGTCTGAATCGAGCCGTG
TCTGACGCGTTTCAGCGTCTTAATCCTCGTAGACGTCGCAAACGTGAACAGCTGAAGGTACGTCAGCTCATCCTTTTCTTGAATCATCGGCGCCTTGTTC
ATCACCTCGCATTACTCGACTTGTTTCTCAGGAGGGCAAGACCGAGGGTTCGAACGCCCCTCAGTCTGCTGCACTTCCTCCGACAGCAGCGTCATCAACC
GGCCCTCCGGCGCTTCCTGTCCCGGACTCTTCACTCCCTGCGGTAGCTCCTGCAGCACGCCCCGTCGTCATATGAAGACTCGGTCCAAGTCTGTACCGTC
TTCTCCAAGTTCATGGTCGCCACCTCTTACACCAGCGTCTTCCTCAACTCCTGCCGAGGTCGACCTCAGCGGCGACCAGAGTGACGTGGACATGGGGAAT
GCTGATCCAAGCAGCGTCCCTTCGGTTCAGGAAACCGCCACAGAGCCTTCGGGTAAAGAGGAGGACCCTGGGGATCACAAAGATGTTCCTGATTCTCCTG
ACGCGCCTTCGCCTCCGTCTCAGGGTCCTCCCAATGTGGCCAAGCCACCAGCTTCAGCGATTTCTCCTTCTCCAGCCGACATACGTGCTGCTGAAGAAGC
TCTGCGCGAGATCGAGCAAATGCGACTCATGTTCGGCTCAAGTGATGAAGGTGAAGAGTCGGACCACACTGTCCCACAAGGCAAGTCTACTTCGGCGTCT
GTTGTGACGTCCAAGACAGTTGAAGTTTCGGGAGTGGTTTCTACAGCAGGGTCTGCCCCTGTTGAAGCTGCTCCACCAGCCTCCGTGTCTTCAAAGCCGG
CTCCGATTGTTCCGACGGCTGATGTACCAAGCGTGTCTTCGCCCGACGTTTTGATGGAGATTGATGACGATGGAAATGCTGCTGACGATCGTGGAGATGA
CGTGGATGATAATGAACCTTCGGTGGATGATTCTCCTGATGCTCCCAGTCGTGGCAATGATGTTCCGCCACCTACCGATCATTCAAGCACACTCGATGAC
GAAGATATTGAAGATTCCGAGAGAAATTGAAGCAATCTTGGCCCAGCTCGTCCTCCGACTCCACCTCGGCCAAATCCTTCGCCGATGATGACTTCTCCAA
TCATAGTTGGTGGGATCGCCTCCTTCGCCACCGGCAAGGCACCAAGCACCACCATCTTCACCTCCTCTTCCGGTGTCTCCTCGTCCGTCTTCTTGGACTC
TCGATGCTGGGCCTGGGCGCATGATCACGGCCACCTACACTTCGGTGCCGCGTCGTGGTGGTGCACCGTCGGTTGAGCCGTTGCCTCACCGAGTGTTGCC
TGGTGTTCGCCCTACGGTGCCGGCTTCGTCCACCTTGCCACCGTGGGTTCTTTCGTACGTGGACATGGCGTTTACTGACGCAGGCGCCAAGAAGTGTTTC
GAGCGACTCTTGAGCTTAACCCTTCCCGAACCAGCTGGTGAGGTGACCGTGCGTACAACGTTGGAGGGTCTCCAAGCGTACTTTGATTACTCGCATCCTG
ATCACCCGTACCAGCAACTTCGGCAGCTCTATCATCTTCAAGCCTGTCTCTTCGACACTGTCGGCTTCAATCCATGCGTCCCCATCTCAAAGCGTGCTCC
GATTGAGATCCGTCTCAAGATGATCTGGGCAAACCTTCGAGGTGACGGCGGTAAGCAAGGTGGCCTCGGGTTCGCGTTGTGGGAGCGTATCCATTGGCTT
CCGTTGGCTGGTATTGAACGAGGTCTCGCTGAAGAAGCTAAAAAGGTTGGCCACGACAAGGAACGCTTGAAGGAACTGAGAACGCTGTTGTAGAAGCTCT
TCAGTGAGCGCGACCGTCGTGCCGATCATCTTCGTGAAAAGTACCGTGAGCAGTACATGGCGTGGAGTCGTGACTCGGTTTCATCTAGTGCTTCCGGCGT
GTCATTCATTCGTCCCGAGTTGCTTTTGGAGCCGTCTAAGCCGTGGTACCCCATTGAAAACTTGCCATTCGCACCTCAGACATCTGACTGGCTTTCCGAA
GTTCCGGCTCTCGACGCTCGTCAGCCCTGGCGTACTGGATGGATTAATGCGCCGCATCAGCACCCGTACAACACCACGTACTTCCCGTGCCAGCGTAATC
CGGAGTTCTTCAATCCTCGTGGTACGCGTTTCGTGGATGTGTACCGAAGCGTGATCGTTGACCCGTCTCTCGATTCAACCGAGCTTATTCCGACCTGGCG
TTCGTTGTTTGACTCGCCACCGGGTACTCCACGTCCTGCTCTGGCTGCTGCTCCTGTTGAAGCTGGTACCGAGGATTCGCAGGGTCCGGCTTCAGCTCCA
GCTGCCGAGGCTCAGGTTCTTGATGAAGAGGAGAAGGAGAGTGGTGACTCGGCTTCGTTGACACTCTTGGCCACCGCGGCCATACACTTGGAATCGCTTT
GAATCCTCGCTGCACGTTCTACGACGTTCCCCAGCATCTCAGCTAACTGTTGAGGTGTCCCGCGTGACTTCGTTTTCAGTGATCGCTCCGCGGTCGGCAT
TCATGTTTTCTTATTCTTAATCCACTTCCACAGCGTAATCATGTTCATGTTGTTCTTCAAATGCATATACAATTTGTTGTTGCAGTAACGTTCTTCGTCT
GTTACCACAGGCTGCATCGCCCTGTGGACAGTTCATACGTGATCAAGTCACGCTTGTCTTCGTCCGCCACTTGCGCCATCTGCAGCCGATTCTCGCTCTT
CTTGGCTCGCAAATAGTCGTACAGCAGACCTCCACATGACAAGTTGGATGATGGCTCCCAAGTTGTATCTTCATAGCCCACCCACTTGACTTTGAACTCG
CGTACAGCACGCTCCGTGCTCGTCGTCAGTGGTGTTCTGTCGTCGAGGATGGCCTCGACTTCATATTCACCGGCAACTTGATCTGGTTCCCAGCTGTCCT
CAGGCAGCAGTTCCTCATCGAAGTCGAGTCTTGCTTCATTAGTCGCGTCTAGTACCAACCGAGTGTTCGGTCGACTGTTGAACTCGCTGACAGCCTTGAG
TCTCGACACATGCACTACTGGGTAGAAGCGATACCCACTTCGGTCAGGCAGTTCCAGCTCGTACGCAAACTCTTCCACCTTGCGCTTGATCCGAAAATGT
GCATGCCATCGGTGAGCTAATTTCTTCGTCAAGCCCGGTTTGACGCGTTCCATGTACAACCACGCCCGGCTCCCAATCTCAAAAAGAGATCTCGGTGGGG
CTCTTGCAGGATCTTCCATCTCTTCTGAAGCTTCTAGGGGGTCCGCCGAGTGTTCGTTTCCACTTGGTTGAGGTACAGCGGCTTTTTTCAGTCGACGCAG
GGCATCATTATGCTTTTTAGCCCTTCGCTCCTTTTCTACAGCCTGATAATCTTTGGCCATAGTGAGGGCGACCTCATGTTGTCGATTGATCTCACGCCGC
CACGCTAGTGCGTCAGACTGCTTGCCGAGTCCTCGTTTGAGTGATGACGACATTGCCCGCAACGTCGACTGCGCATCCCAACCATGAACGAGGTAGAACG
GTGTTTCCTTCCTTGTAGTGTCCTGAGAAGTATAAATAGCAAACACCAGCTTCTCTGCGATTTCATCCCAATCTTGCTGTAAAGGGTCTTCCGCGTACAC
CCGTACGGAACCAATCACTGACTTCACCGAGCGTTCCTGCTGTCCATTAGCCTGTGGCCGATAGCTCAAAGTCGCCCGTGATCTTGACTGCATCACCGCT
GCGAACGCTTGGAACACCTCGCTCATGAAGCGTGGGTCGCGGTCATGCCTTATTAATGATGGGGCTCCGAACCGTCGGTACACACATTCTTCGAACACTT
GGGCAACACTCAGTGCAGTCGTATCTGACATAGCCTTGGCAATAACGAATCCCGTGAACGAGCACTGAAATAGGAGCAACGCCGTGTTGCCCCTGCGAGA
TTTCTGTAGTGGGATTGTGGTGAAGTGCTTTCTCAGAAATAAGAGAATGGGCCTGACGCGGGGTCACTATCCCGAATCAGTGACAATTTCAATTGTTTGG
CACGGGTGCAAGTTGCCTGTGGTGGATTAGCCATGACGAGCGGCACCCCGTATGGAATGACGATGGATCTGGTATGAGTGATGTACGGGAAGGCAAGATC
CACCAAGACCTATCTCGGATTCACCGTTACCCGGATTCACTTAGTTGGATATGGGATATACTATAGACGGGTGGATCGAGTGTAGATCCTATGGAGGAAT
GATGGTAGGCGCCCCCTGAAGGAGGATCTGGCAACCACGGCTAACGAGAAGTCAGGATCCACCGCGAGGTATTCCGGATCCNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGGAAAGGGATGGGTCCGG
GCGCCCTGTGAAGGTGGGATTCTTAGTTAGCCACGGGCTAACGGAGGAAGTCAAAGATCCCACCGCGGAGGTACCCCGGATCCTATACTTCCGGAGTCGG
GGTTCCAAGGAGGGAGGATTCCCGCCTTGGAGGGGACCGGGATCCAGAGTATAGGGGATGGTGGGATGTAGTGGGTTCTCGAGCTTTCGTGGGACAATGA
AGATCACAGAACGGTTGCGAGATGATGTTGGATGATTGGAGAGCTCAGATCCACGACGACTGTACACTCACACTGAAGTGGTCCAAGCGACCTGGATCCT
GATGAGTGTACCCATAATAGGGTGACCATAATGATTACGCCATGGATCCGGTGGATCTGAAGATAATACAGCTGGGGTGATGGGTCAAGGGAAGAAAGGA
CATGCAGCCGATCCTGGTAAGGGATTTAACGAGGGAAAGACATAGAAGGTAGAGATCCAGGCAGGTATAGGCTTAAGTATCAATACAGACTTCTATTTGC
ACGATAACACGCAAGTGCCTTCCTGCCCTCAAGAACCGGAACTACATTGGCCGTACGAGCTCGGAGAAGGTTGGGAATTGCGAATCTAGTGTTGGTAGTG
ATAACTGGATAATACATTGGCCAGTTCCTACAACCTAGTAAGCTTTCCCATACACGTGCAGATCCGACGGGTTAACCGAATTTACTACTTGGTCGGTTAT
ACCCTAGAGGCTCTCAACTATCAAAATCCCGTCACAGGAGGCGGCAAGTACGACGCAAAGGAACGCAAAGGCAAGGGACACACCCGCAAGGCAACCCTGC
GGCCAGATCCACGATCTAGGCTCCGGATCCATAAGCTCGAATATTCGCTTAGGATTCGGAACAATCCACGGACGCAGAGTGAAGATTTTCCACTGCTGCT
CTACCCCATCCCCACGTCTCGCCAAGACACTCAAGCTTCACCACTTGAACTCTTCGGAAGTTACCGAGAGAGCAAGATCCCGTCCTACCGACGGGTACAC
AAGGTGAGGAAAGTTCAGCAGAACACGGATCATCGGGGGACCCCCTCCGTTAGTCGGTGTCTGGGCGCAGTTGGTAAGTTGGATCTGGCAATCTCGCAGA
TTTTGCTGATCCCGCTACACCACAATAATGCGCGTGCCCGGATCTTTTGGTGACTCGGGATTTCACCGTGAGTCCCAAGAAGATGCTCAAGTGAAGATTG
AGCCAGGGGAAGAGGCGTCGTCGGAGGTCGGATCGACGAAGACGCTGCTGAATGAAACAAGATCCGCGGATCGATGGAGTTTTGGGAGGAACTCTGTCGA
CGGAAGAGAGGTGGATCCGGATCCGGATCTAGGAGAAAAACCTCTCTATCCTCCCCAGGTCCCCTCGGGGACCCCTGCGGATCTTGACGCAAGTCAAGAT
CCGCTAACAAAACAAGGGAAAGTGAAGGCGAAACGGTATGCATTTGCAGATGCACCGGTTAAGCCAACACCGTACCTAAACCCAAGCCCGCTAGTCGAAG
AAACAAGAAAGAAAACGAAAACGAGTAAGACTACGCGGAAGAAGATGCAAGCTCCAGAGTCGGAAGAAGACCAAGCTGGATCCAGGTCAAGCTGGTCCGA
CAAGGATCTCGAGTTTGTGTATCGCCACCAAGCTCTACGCGATTTCCTGCATCAAGATCCTGTCATGCAGATCCTGAATCCACGACAGATCGAAGATCCA
AGGGAACCGGTGGGAGCACCAACGAAAACGGCGAACAAGTTGGTGGCAGTCAAAGATCTATTACGTTTGCTTACGGAGTCAGGCATCGTAGCTGATGCGT
TCGACGCAGAGGATATCTTCGAGCTAGACCTGGATCTCATAGTATCCGCGACGCGGGACCTCTTTGCCAGAGTTAAGTCCATCACCGGAGAAAGGTCGCG
CACTACGGATCCGGTGTCGTCGCCGAGGGTCAGCCAAGCTGCATCCTCGAACTACGAATCCGCCGCTGAGGATGAGTCAGACACGTCGTCCGAACCACGA
CGCATGACTTTAGGACCCTCCGGGGCATCCATGCTGGAAGCGCGGGCGAGGAGCCGAGGACAGGAAGTCCCTGTGACCGCGAAGGCTCGGGATCCAGTAG
GCCCCACGCGTGATCTGACACAATCCAGCCACGATCGAGCCAGATCCGGCAAGAAGCCAGTGGGATTATCGTCAGATCGGGCTCAAGGTAATCGCCTCAC
GGATCCGGTCTCGCCAGTGGACCAGACGGCCACTGGCTCTTCCGACACTTCCTCGGGCACCTTGCAGCGACACTTCGAAGCTGCGATGAGTCGTTTCCTG
GCCGAACAGGGTATGAGAGCGCCCGTGCCACAAGTGCAAGTGCTCCACGAACATGGAGCACGAGACGTGGAGATGGAGTCCGTGGAGGGAGACAATTCAC
ATGATGAGTACGACCCAGATGATCGGGATGGCCCATCAACTTCGTCGGCAGTGGTAGCAACAGCCAGAGCCGGGGCAGGTGGATCGTCCATGATCCAGAG
GGTACGGATCTCAGCCATATCGGATCTGAAGGAGTTCACGGGCAAGGATCAAGATGAGGACCGAGCGAGAACATGGATCAGCAAAGTCAAGTCGGCCCAC
ATGAGAGATCAAGCGTCGGATGCTGAGAAGTGGTTGACCTTTGCGGATCTGCTAGCGGGGCCAGCCAGGAACTGGTATCGGCAGCTGGGCAGATCCACCA
GGAACAAGTGGCCAGATTTGCTGCGCAGTTTCCAGACCCAGTACTGTGGATTGGGAGTGTCGGTGGCACGACAATACTACCACGCTCGCCGCAGATCGGA
TGAATCCCCGCTAGAATACCTACATCGACTAAATGTGGCCGGTCTACGGGCCAAGTTGAAGATCAAGGATGGGGGATCCAAGGTACTGCGGGAACACGTG
GATCATTTCATCGAGACGGTGGGAGACGTGGATCTGGCCGACAGGTTGACCCTGCTACGACTTCCCGACGCAGACGAGCTTGAGGAAGTGCTGCGGGCGG
TGGATCGCGCGAAACACCGCCAGAAGAAGGCGGCGGTCGGATCCGGCAAGTATCGCCAAAAGGCTCCGACGCCTACGGCCCCAGCTCGACGTGTCCACCA
AGTCACGGCGCCCGACTCAGGAACTGAATCAGGATCCGACGGCTCGGACTCCGACCCTGAAGATTACCGTCGAGTCTGTCTCACTGCGTCCAACGATCGA
ACGGCGAAGACAGGAGACAGCTCGCGACCGAGGGATACCGTACCCGGGGACCGTGGGATGTACAGATCCCGAGATCTCATGGACGGGACAGCCCAGGTCA
GGTGTTCGCAGTGCGGATCCCGAAAGCACACTGAATCTGGATGCTGGAAACATCTGGTCTGTGAGAAGTGTGGCAAGAAAGGTCATCCCGGAGATCATTG
CTTCTACGTGTGTCGCGGGTGTGGCGAGATTCACGACGTCGGCAAGTGCCCGATGGAAGAATTCTACAACCAGATCCGCCAATAGTTTGATCCAGCCAAG
CACAGAGGGATGTTGCCAGAAGTGGCCGAGAAGATGTTAAACTAGGACGCTCGCCGGGTTTGAATCCGGTACGAGCCGAGCGTTCTAGGTACTGCATTTA
TGCATTTGTGAACAAGACATCGCTAGATCCAGGTAGGAGGACCCTAGATCCAGTCGATAATACACGTGATCTACATGAAGTGTCAGTTGCCAAGATCTCT
AGTTTGCGCCAAGTGGATGAGTTTGCCAGATCCGAATTTTCTTCAACCCTGGATCTACAAAGGGGAGAGGCACGTGGTTATTGGGAGAAGCGCCAACATG
GCCGATGGTTTGAGCCTACCAAGGGTGAGGTCACTGCAGATCCACCTAAGGTCTGTCAGTTCACTGGATCCCGTGGATCTGAGGATGTTGGATCCATGGA
TCTGCTAACCGGGGAGTCCCGTGGATACTGGAAGTACCATGCCCCA