Description :
From Genome Similarity Track
Location :
contig_74:97700- 100600
Transcript NameFunction/comments
g10035.t1hypothetical protein

Sequence
2900 bases(100 bases per row)
CCCAACGCTTCCTGCGGCGCCGCGGTACGCGGGCAGCACGATGAAGGACCGACGGAGCTTCATGCGTGCATACGAGACCTACTATCATGCGCTCAGTGCG
TTCGACACGGGTTTCGCGCGTCCATTTATCATGCCGGTCAGTGGATGCATTGAGGAAAGAACATGCCAGATGATCTGCATGTACGAGTTCCAGAAGAACC
CCAACGAAGTGTCGGAGGGGGAGTGGATTTCCTATTTCCTGCAAGCCCGGGAACCGGAACTGGAAGACTATACGGCAGTGGACCTGGCGATGAAACAACT
CAAGATGAAGACAACCTTTCCTGATGCCGCATCACGAATGGGTCAGCTGCGGGCTGACATGCACCATATCCTCGACGAACATACCGTGGAGCAGGTGATG
CTGGAGCGGGAACAGAAGAAGGTGGTGAAGTATTTTGTCGCAGCGCTGGAGCCGGCGGAGTTCCGCGAGGCAATCCAGAAGCGTCTGCAATACGCCCAGC
ACAAAGCTCTGAAGACAGATATTGTCAAGTGTTACGCGTGGGTATTGGAGCAACTTAAGGCATATTTGGTCTGGCAGCCAGCCCAAGTAAAGCCCCAGGC
TCGCCCGCAGAGCAAGTTTGGTCAACAGCCTCGCCGACCACAGCAGGAGGACAACCACAGCCATGGAGCGAAGCCTGGGCCGTCATCGGGAAACAGTAGC
AGAGGTCCGACAGAGGGAAAGCCACCCCCAAAGCCGCGCAGTGGAAACCCGCCTCGTCGTACCTGTCTCAAGTGCGGATCGCAAACGCATTTGGTGCGGC
AGTGCCCAGATGTAACCCCCGATGAAGTGGATAAACTCCTGGCGGCGCGAAATCCGTCGACCAATAGCGCGACTAGCACTCACTTCAAGCGTGTGCAAGT
TGTGAATGAGGACAGTGCCGAGACAGGTTGTGCGCAAGCAACTACGTCCAATCACCCCCTGCGTCACTCGATAGGCTTAAGGGATGACGACGGTACGGCT
CAAACGACTATTGACGGCTTTACTCTGCAGACATCGCTGCTAGATAGTGGTGCGGATGACTCCGTGGTCAGTGGAGGGATTGTGCGCGCTTTGGAGTCGG
CTGGTGTTCCTATCCTGACGTTTTCGGCTAACACGGCATTGGAACCTGTGGGTGGGCATTTGATCCCAGTTGCCCGGAAAGTACGTTTTGGTGAAGTGGA
GTTTGCGACCTCAGCAGGTCCACTACTTCTACGCAACCTGGATTGTTTGGTGCACGAAGAAGATCGATCGTTGGCTCTAACCGTGGGCCGTCCAGTGATG
AACCGCCTAGGTTACTCTACAGACGGTCTGCTCGCTGCAGCACGAACACGCCAGCCCGAGTACTGTCTCACGGAACCAGCAGAGGAGGACTCCGACAAGA
ACAACTCGCCGTTAGTCCGCGTACAGGCGATGCGAACTCGGCTCCTTGATGAATTGGACGTGGACGGTGATGATTTGGATGAACTTGTTGCATCTCCAAG
GCTCGTCGCAGAGACCACGCGGGCCGTACAAGAAGCTCTGGAACTTAAAATACAAGAGGCGCGTGCGAATGGACTAACAAGCAAAGAAGGGGACGATTTG
CAGGAGCTCCTGTTTCGCCACATCGACGTGTTCCGACTCTCATTTGGTGATGACCCGCCAGTGCGCGTTCCCCCCTTCGCGTTCATCTGAAGGAAGGAGC
TCGGCCTGTGAAGGCTAAAGCGCGGCGCTATCCGCCTGATCACAAACGGTATTTGGAGGAACACATCGAAGAACTCGTCCGTCACGGTTTAGTGAAGAAA
AATCACCGCAGTCGCTGGGCGTCAGCACCTCGGATTGTGGCGAAACGGAAACCCGGGGAATACAGGATGACTGTCGACACACGGGCCGTCAACGCTCTCA
CCGAGCCGATGCCGTGGCCTATGCCAGACATCGAGGCAGACTTGGCTCAAGTCGAGGACTCTGAAGCGTATTTCACGATTGACTGGTGGCGAGGATATTG
GCAACTTCCACTGGATGAAGACTCACAGGAACTCTACACTATCATGACACACCGCGGGATGTTTACCCCGACCAGAGTGTTGATGGGCAGTACGGATGCG
GTAGCATACTGCCAAGGCGTCGTCGAGGAGATTTTTGGACCTCTTCGTGGCGGTCAGATCCTCGCCTGGCTCGACGACATTCTCGGATATGCTCGCTCGC
CATCCGCGCTGCTGGTCGTGCTCAAGAATGTACTGGAGTTGTGCGCAGAGTACGGTTTGAAGTTGCACCCTCTAAAGTGTTGTTTCTTCACCCGTGAGGC
TACCTGGTGTGGACGAATGATTTCAGCACAAGGTGTTCGTCACTGCCCATCTCGGATTGATGGGTTGGTAAACTTGCCGGCGCCACACACAGCAGGGGAA
CTACAGCAGTTCCTTTGTGCTGTAAATTGGATGCGTGGCAATATCCCCGAGTACAACGCTCTCACAGCAAAGCTGTACGAAGTCCTGGAAGCGGCGGCTA
CTGTTGCTCAAAGTCGGAAGAAAACGCGGTTACATCGGGTGCTGCTTGACTCGGTCGGCTGGGGTCCGGAGCATGATACGGCACTGGCCAATGTCAAGGA
CGCTCTGCTCAAAATGGTCACATTAGCCCATCCGAAGGACGACTGGGAGGTATGCCTATTTGCTGATGCGAGCCAAACTCATTTCGGAGCAGTGGTGTCG
CAGATTCCACCGGAGGATGCCGGCCTGCCCATCGAGAAGCAGCGTCACCAGCCTCTCGCTTTCTTAAGCGGATCATTCACTGGGGCTATGGCACGCTGGT
CTACGATCGACAAAGAAGCCTACGCGATTGTTGCGGCATGCAAACGCTTGATGTATTTGCTGCTTCGTCCGCGAGGTTTCCGTATTTTTACCGACCATCG