Description :
From Genome Similarity Track
Location :
Scaffold_429:977- 4454
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_429-fgenesh-gene-0.0Amino Acid/Auxin Permease (AAAP) Family
Pytir_DAOMBR486maker-pir_contig_429-fgenesh-gene-0.1Gene of unknown function
Pytir_DAOMBR486maker-pir_contig_429-fgenesh-gene-0.2Lectin domain-containing protein

Sequence
3477 bases(100 bases per row)
TCTTGATCATCTCGTGCTTCTTCATGGCGCTCGCCGCTCTCGGCTACAGTGTCACTGGCTGTCAAATGTCTGGCAACCTGCTCTTTTCGATCGCGGGCTC
CGACACCACGGGCGAGACGACCCTCGGCTTCGTCGCGGACCGCGGTGCCGTCGTCATGGCGTACTTGTTCATGCAGCTGCACATCACTATCGCATTCTCG
ACGTTCCTCCACCCGACCTTCTACATGCTCGAACGCATGGTCCTCGGTATGCATATGGACGAGGTTGTCGACGGAGAGGGCGAGGACGACCAGCTTGCCA
AGTTGTCCTACGTGTCGGCACAAACGCCATCCATCTACTCTAAGTCCACAACGAGCATCGACCTGGAGCACAATGTCGCTGAGCGCCGTCTTGTGACCGT
GAAGAACACCGACGAGCTGGCCGAGTACCGCGGCGCGCGCAACGTGGTTCGCTACGTGCTTCTCCGTACTGTGCTGATCGCCTGCCTCGTGGCAGCGTCT
GTGGCTCTGAGATCCCACTTCCTCGCGCTCGCGGACTTCATCGGCGCCTCGGCTCACTCGACGAGCTGCCTGATCCTACCGCTCGTGTTCTACCTGAAGG
TGTTCTGGAAGAAGACTCCGGTCTGGGAGAGATGCATTGCGATGTTCATCATCGTCGTGTGCATCATCTGCGGCATCTACGTGTCCATCCAGGCGGGCAA
GGAGCTCTTCAAGGGCACGGAGGTCGTAACCCCGGAGACGCCCGTGTTCCCGTTCTGCCCAGTCGAGCACAAATTCGTCTCGTACTACATCAAGGCGAAC
GCCACTGCTTAGAACTGGATCACTTGAACTGTAAATAATAATGGCAAACAAATACTCGAAAAAAGCAAATACCCTCTTAACTGAGTCAAACTATTTCGTC
TGATTCTGTCTGTTAAAGAAGCAATTTTTGAATTTTCTGGTACAGTGATAACCGGATAAATACACATTGCTTATTCTGATACCATTCACATAACTTGGCA
TCAGAGGTTCCCTTAAATCCCAACTTGACTAATTCCGAATTTGTTTCCACAGGCGCACCCAACTCAGGTGATCGAACGAATGCATTCTCCAGTTGATAAA
AAGGAAAGCGAGGAAGGACGAATGGTGCTGTTTGTGCTTCTGCTGCAATTGCTGCTGCTGCATGAGGTGTCTGCGCTACGATTCCTGCGCGCGAACGACC
TCGTTGATGTGTGTGTGAGCGTGCGCAAGATCAGCGACTTTGTGGCCGTGCACTGCGACTCGGACGCGACGACGACGCTCGATCCGAAATGCGTCGAGAG
CTTCCAGGAGTACGCGCGCGACAGCGACGTGTTTAAACAGTGCGAAGCGCAAGCTGGACAGGCAGGTGCGAATGGAGATGATGCGCAACAGCAGCATTCA
CTGCACCGCTTTAAAGAGCTCTACGGCGCGTGGCAGCAGGCGCACGTCTGCAAGCTCTTCCACGCGACCGAGAAGAAAGCGGCGCACGAGTGCTCGGGCG
ACAACGTGCACCGGCCGTGGAACGAAGCCGCGTGGCCGCTTTTCTGCCACCAGACGTTCATGAGCTACAAGGAGAACCGCAAGGACATCGACGCGCTCTG
CGGACGCACCGATAACTCGCCGGCGTTCTGGGAGGGTTTTGCGGACTACATCGCGTCGCCTACGTGCAAGCAGTACTACGACTTTGTGCGCGACGCCGCC
AAGCGCGGCTGCGGCAGGCAGGACTCGCAGAGCAGCGAGGACGCGGACTCGTGCGTGCGCATGTTCCAGTGGTACCGCGAGAACCAACGTCAAGTGGAAA
TCGAGTGCCTAGAGCTGTACAACACCAAGCCCTTCTACCAAGGCTTCTACCGCTGGAAAAAGCAGGCACACCCTTTCTAGGCTATTAACTAGCGACGCAT
GCCAGGCTTTTTGCGATGCATGAAGCCCACCCACTATTTGACATTTCTAATATACTATTGAGCCAAAGGAATTGTGTGAACAGTCGCCTCGATCTATTGC
CACAGCGCAGGTAAATCCTAACACTATGAGAAACAACGGTGCCATCGCGGCATGTGCGCTGCTAGTCTCTTCGCTGTTCTGCTGGCTTAGTGGCGCTGGT
ACGTGTGTGTGCTCTCGCTCTTTTGTCCGGTATTGTTAGTGATGCGTGGTTGGATAACGAGCGTGGACTTGCCATGGTTTGCAGAGTTTGTCTACTACGA
CTTCAATGGCACGACCGGCTTGGTGCTCAACGGTAACGCTGCGACCAGCAGTTGCGCGCACATTGTGAGGGTGCGTTACTTTCATGATAGGCGCTCCGTT
GTACTACTATTGCTACCAGTCCGTGTATTGTTCATGCAAACGTGCTGCTATCACACTCTCTATTGCACCAGAACGAGTACTCGGAGCTCGCCGATGCCGA
CGATCTGCGCGAGGCGTCTCTGGAGCTAGTACAGTACCAGCTACTCGAAAAAGTGATGGTCGAGACCTCTGAGACAGAGAACCACACGACCAGCACCAGG
ATCGCCGTCGAGACTGCGAGTGCGGGTCATCGCGACAACTTTGCCAAGAGCGAGGAAGTGGAGCGTTGCGCTGTGCGGCTGCGGCTCACGGCGTCGCANN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCGGTCTGGTACGCGGAGTCGCTCCCGGTGCTCCAGGGCTTCGATACGCGCTTCACGTTCCAGCTCA
CAGACCAGTCCAAGCGCTGCTTCGAGGTCAAGGATCAGAACTTTGGCGTACGCCACTACCGTTCGTGCTCTGTGCACGGCGGTGACGGCTTCGCGTTCGT
GCTGCACTCGCACCCAAACAAGACGAGTACGCTCGGTGTACAGAATGCGACCGCGAAGCAGCGCAGCCAGATGGGGTTTGAAGGACTGCAGAACTCGCTC
GCGATTGAATTCGACACGTGGTTCAACACGGAGCAGCCCGACACCTTCTACGACCACGTGGCGATCTACTCGAACGGCCAGAGCGGCAACTCACTGCTCG
AGAGCGCGCGGCTCTCGGCCACCGTGCTGCACGACCTCGCTGATGGGAAAGTCCACGCGGTCAAGATCCGGTACTACAACGAGATCAAGGTACGAAGTCC
CATTGTGAGTGTCGTTTTTCCGATTGTGTTCTCACCACTCAGATGGCCTTGGTCTAGTATGAGTACGCACCGTACTTCTCGTCGACGATTAGCCTCGTTC
AGTACATCAAGGACGTGTCCGAGGGGCGTCGCGTCGGCACGCTCGTCGTGTTCATGGACGACGGTATCGAGAGCGACACGCCGATGCTCGCGATTCCCAT
CAACCTCGCGGCGACGCTGCGACTGCAGGTGGACGAAGCCTTCGTGGTGTGTTGAGCCATCTATCTCGTCACGCTCTGAGGTTTGCTGAGATTACTAAGA
GCGCTTATAATTTATTTGGACGCAGGGATTCACGGCGTCGACGGGCAACTCATGGCAGAAGCACGACATCTTGGGCT