Description :
From Genome Similarity Track
Location :
Scaffold_2967:977- 2402
Sequence
1425 bases(100 bases per row)
AACGAAGTTCGCGGCAGACCGCGAAGCACCGGTAGAGACCGACCCTGTACTACAACTCGTCAACAGCCCCGTCGCTGACATGTTTACGAACGGGGAACCA
GACGAATCATCGCTGGTACCTGTATTTGGTCGACGGTCGTTTGTGGATGACATTTGCTTCGGTGGCGAGGATTTCGACAGCTGCCTGGCGACGCTGGACC
GATTGCTGGCAAGGTTTGCACAGTGTCGGATCAGCATTAGCTTCACCAAGAGCATCTTCTGCCAGCCCAAGGTGGACTTTCTGTCGCATAAAATTTCGCC
AGAAGGCATCAGAGCTGACCCCAAGAAGCTTGCGGCTATCACCGAGCTTTCGTTTTCAACGAGCAAGAAGGGCATGCAGTCGTTTCTTGGTGCGGCTAAT
TACTACAGTCGCTTCATTCAAGACTTCGCGGTCTACGGTGCGGCGCTGTACCAGCTCAAGGATGAAGACTTTGCCGTTGAAGGTGGCCTTTCTGTGGCAC
GTCGTTCCTTCGAAAAGTTGAAGATGAGTGTTTCACATTCACCCATCCTCAGGCACTTCGATCGGTCGAAAGAAGTTCACGTCATGCTCTTTGCGAATGA
ATGGGCGTTGAGCACTACGCTAATGCAAGAACATGAAGGCAAGTTACACCCCGTACGGTTCCTCGGTCGGGTGCTTAAGGAAGCCGAGATGAACTACCAT
CCAGCTGAGAAGGAAGTTTTGGCGTTACTTCTGCTGTTGAAGATCTGTTACGTCCAGCTGGCACGAAAGACGCTAAAAAGCCTACATGTCTATACACGAT
TCCCGACGCTTAGAGTGGGTGCATATAGTCGAAGTCTCTCTTCGGACGCGCGGTCCAGTTTTGCCAGTGCTGCTATCGCAGTGGCATCTCTAGGTGCAGC
GCGTGAAGAAGAAGGATGTCGCCTTCGCGCAGCTACTGCAGTCAAGCATCACGAGCTTCGTCGACCTGGAAGACTCTCTCGCGCCGATGGCACCTCCAAA
CAAGGGTTCCCCGACTATTCGAATGGACCCCGCGTGGCTGTACGCCAAGCTTTCCCGTAATTACAGCGGATTCGTCATATCTTTTGACGGATCAGCGAGG
ACAGAGAAGTACGGTGGCTACGGGAGTTGTTCATGGGTGCTGTGGAGCCTTCCTGAGTGGAAGGTAGTGATTGCTGCAAACGCTTACCTCTCGGCTACCA
CGGTGAATGAAGCAGAGTATAAAGGTATGATCAACGGTGTCAAGGCTGCTATTGCGCACGGTGCCGAGGATTTAGTCATCGTTGGTGACTCAAGGCTCGC
GATTCAACAATCACTAGGGGTGATCGCATGCAGAAAGGAAACTTTGCTAGCGCTGCTGAATACTCACAAGGAACTCACGGCCAAGCTTCGATCAGTTAAA
TATCTTCACGTTGTACGAGAATACA