Description :
From Genome Similarity Track
Location :
Scaffold_728:9769- 14839
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_728-snap-gene-0.11DREV methyltransferase
Pytiw_DAOMBR242034maker-piw_contig_728-fgenesh-gene-0.3Conserved gene of unknown function
Pytiw_DAOMBR242034maker-piw_contig_728-snap-gene-0.14Phosphatidylinositol n-acetylglucosaminyltransferase subunit p
Pytiw_DAOMBR242034maker-piw_contig_728-fgenesh-gene-0.7Ubiquinone biosynthesis monooxygenase

Sequence
5070 bases(100 bases per row)
GGCAACGTGACCGAGTCCATCGCGTCGCTGGTGGACAAGGTCACGTCCACCGAGGTCTCGGGTCCGATGGTCAAGAGCCTCAACCAGCGCGGCTTCAACT
GCGTGCAGACAGCGGACCTCGACCACGAATTTGTCCAGGGGCGCCAGCCGTACAACATTATTAGGTACGCTCTCGTGAATATGTTTTAATGGTGGGAATT
CATTATTGATATATTATTTTTTGTCTGCTATTTGGCAGTTTGATGAACGTGCTCGACCGCGCCGACAAGCCTTGGACCATGCTCAAGCAGATCCGCAGCA
TGCTTCACCCTGCAAATGTGCGTGAACCGCCCTCATAGTATTATTTTGAACTTATTATGCCTTGCTAATATTTTATTTCGTACCCAGGGTTTGTTCTTGC
TGGCCGTGGTGCTCCCATTCTCGGCATTCGTCGAAAGTGGCACGCAGCGCTTAGCTCCGACTGAGACGCTCAACATGCGAGGCGGCCTCTGCCACGAAGG
CGCATCGTTCGAAGCCGCGGCGTCCGTGCTACTGAAGAACGTGCTCCAACCTGCAGGCTTCAAGCTCGTACAGTTCAGTCGCGTTCCCTATTTATGCCGC
GGCGACCTGCGGCAGCCGTACTACGTGCTCTCGGACGCGATCTTCGTGCTACAAGTGGACAACGACGTGACGCCTGTCGAAGACGTCGAGTAGCAGGACT
GCAGCGCCTCCAGCTCGGGGTCTAGGCTGGCGCGAATGGCTACGCAGTAGAAACCTGTATCCCATGCACCAAATTAATAGGCTAGCCAGCGCAAATAAGG
AGATTCGAAGGCACTGGAGGTATGCAGTTATTTTTCATTCTACTACACTCGCTGGATATCACTCATTCGAGCTCATCGCCGCTGTAAGTCGGCGTGTGTC
TGTCTCATGATCCTTTGGTCGCTGGTCTTGATTGCCAAATCGATTAAGGCCCACGCCAGTCATCCGATAGCGAATAAGCCTCTCAGGAGACTGAAAAAAC
AACAACTCGCGCTTCTCCGACTGGATGATCGTCTGCAAGTCTCTCTGGCTTTGTCAGAGAAATGCGCGTCTGAGCAACTCTCGTGATGGTGAGTTGAGTT
GACCTTCACAAGAAAAAAATTGAAGTGTCCTCGATGGGGATTTGTTTAACAGCTTTGGCAAAAAAAGCTAAAACAAGTTGAAGTTGCAGCGTTTTTTTAC
AACTTGCTAGTCAATCGCAAATAGCTTGAACGCATCTTATTTTTTCGTGTCACCACACAAAACACAGGCGAAGAGCTCCGAAGTGGCACCGGTGAAATAA
ATAAATAAATAATACTAATACTGGTAATCATAAAGCGATGGAAGCGATTATGGATTTTGTTATTGAATGGATTGGCCGATGTTGCATACACAAAGTGGTG
GCCGATTTGTGGTGGATATTCGTGCATGATCGAGCGGGTTTCTCAGGTGTTCCTGGTTATATTTTTGAGCAACAAACACAGTCTCAAGTCTCACTGAAAT
TCACCTCGGATTCTTTTTTCAAGAAACTGGATTTTCAGCGAATGAGACACGAGTATTTCTGGAGGATTTATTTTTAGCGAATGAGAAACGCCATTTAGTG
ATTGTCTCCAATTGGATTGGATGAAAATCTATTTCGTACCTCCACAACCCTACGAAACTGCTGTAGTTTTCATTTTAGGTTTAAATTACTTCCATCCGGG
GAATAGAATTGAAACTTCTCTTTCAGCTAGATCTGTCGAATTATTGCTGTTTTTGTCTCAAATCTGGTCAATTCTGGAATTCCATTGATCTATCCCATAC
AAAATGTCCAAGCATCTCCACCTCAACTTGATTCCTCGTAAATAACTTGCACGCGCTTTCGTTCTCGCCGAGGCCATTCTGCTTTTTGCTGACTATCGCA
CAGGCCCCAGCATCGAAAAAGCCCATCAAGCCACGTCCTTCAAGCCGGGCGTATCCATCTGTGCAGGTGGAAGAGAGCCACACACACACACGCGCACTCG
TATACCGCACGAGCGCCATCGACCGCCGACCCGCCCTTCAGTCCCGGAAACACACACGCCAGTCCGTCCGCCAGCGGCTGTACATACACGCTTCGTATCC
ATCTCGCAGTGTCTGCCTTAATTGAACCATGACGCCCGCGATTGACTCCGTCTCGGCCGCGACGCTCGTCGTGAGCGTGTCGGCGCTTCCCGAGATCGTT
GAGAATGGCAAGATGATGCTGCTGGCGTCGTCGTCTGATGAACTCAAGAAGCCGCAGCAGGAAGAACCGCAAGACGCCGACGATAGCGATAGCGACCGTG
ACGACAGCGTGGCGGGTGACGACAAGGAGAACGCGTTTGCGAGCAGCATGACGGAGCGAGCGAACCAAGCGACGACGCAGCAACGAGTTGACGAAGCAAC
GAAAGCAGAAGAGACGGCTGCGGTGCCGACCAAGAGCAAGAAACACGTGCGATTCGACGCGGCCGACATTCTCGAGTTTGAGCCGTCGGCGTGGACGGCG
ACCGTGTCGTCGGATGGCATTCCGGTGCGTTCAACTGCATGATGTTCATGAATGATGGTGTGGGATATTTGAAACTGATGCCTCTTTTGTGGTGGTTATG
ATTAGGTCGGCATGTCTGGCACGCTGCGCCGCCGCACGCGCCAACGTCTGGACTCGTACGAAAACGAGCGCTGCTTGTGGTAAGTTTAGGACTTGTAATG
GGACATGAGTGTGCGGCGTTCTCACTTTTGTGACTTTTATGCCAATTATTTCAGCCGCGTGCGACGAGAGGAGTACATGGAACACGGCTACCTCGAGCCC
GACGAGCGGTTAGACATCCTCGAGAATGCGGGTCACTCGATCTCGGTCATCAGCCATGTCGAGAAGGAGACGATCCGCATCAACCGCGAACGGTGGGAGT
CGAACGAGTTCGATCTCATGTACCAGTACGGCCTCGGCGAAGTGCCCGTGATGGAGATGAGCGACGAGGAGGACGAGGACATGATGTTTCTTGCGCAGCA
GGATAGCGCAGATGAAAGTATCGACATGATGATGGAGGTCGACGACAGCTGCAGTGATAGCAACAACCAGGACGAGAGCTTCTACAGCTCGCGCAGTGTG
CTCGTGGACGCCGAGGTGCGGTTCGCGATGGAGGAGATGGACGCGTACGACACTCGCCGCTACGAAGAGGTGTGTTGAATAGTCTAAGCGCGTGAGGTGT
TGTGTAAAACGAAATTTGTGTTTAGATGATTTGATTTCTGACATCTGTGTTTGTGACATCTGTGTGTGATGTTGTAGTTGCAAACGGACTACTACTCCTC
GGTAGAGTGCATCCTCGGCGACGACGACGACAACACGGACGAGAACAACGAGCTCCCGTACGCCAAGGACTCGTTCGAGTCGCCGATCAGCTTTGCGCTC
TCGGAGATGTCGTCCTCGCCGACGGACGTGTCAGCGGCGTCCGAGTGCATGATCGTGTCGTGCTCGTCGCGCAGCAGCAAGATCGCAGCGTCGACAGGCG
GCATGTCAGGCTCTCCCGGCATCTGCGACGCCAAGATGCGTCTCTTTTGAAGCAATGAAAGCGAACTGCGGTGTCCAGAATGCGAATGAAGCCCTCCCCA
AGTCCCGCTCAATAGTCCAAGCAGCCAACCAATCCCCCAACCGTACAGTACGCCACGCTTGAATCCGCGACCCACCTATTAATTACTCAGCCCGTCCGAC
ATCCGTTCCCGTGAAGAAGCACTTAGCATCACGGTGTTGCTCAAGAGAAGAAGAAGAATTTCCCGTGAAACCCCAACCCAAAGCAGTCAACTCGTAGCCC
GCACCAGGCGATTCAAGTGAAGTGCAAATGAGCTCGTAATGAAATGGCGAGAGCAGATTAGCTGCCAGCGTTCTAGGAAGGTCGTCGCACAGCTCGTTCT
CTTTTTTTTAATATGAGTCGCTCCTATTCTAACGAAATCACATATTTTTTTGATAATAAATGTGGCATGTTGTTAATTTTGATATCAAAGCTTCAAATAT
GGCACGGAAGACGCCGCTGTCCCGAGCGTCTCTCAGTGCGCAGGCCACCGCCACCTCCAGCCACGCAGACCCACAGACGCACGCGTATGCAGTGCCGCAG
GTGCGTCCGCGCTCGCTGTCGTCCCTGTCGGCGTCATCGGCGATGAGCTCGGCGCCGCCCGCACTCTCGTTCAAGGAGCTCCAGCGGCTCAACGCCATGC
AGATGGAGTTCTTCGGCTTCGCCGGCTGGCTCGCGTCCACGCTGCTCTACGGTATGTGCCTCCATGATGTCGCTATGCTCTCTATGTGTGCTACATGCCA
TTATGCTGACGTGTAGCACGTGTGCTTTTCTATAGTACTGTTCCTCGTGTGGGCGTACCTGCCGGACGCGACGCTCAAGGCCTACGGCTTCTCGTACCTG
CCGTCCAAGCACTGGGCGCTCGCGATGCCGTCGATGCTCGTCGTGACGTACATCTTTTCGATCGTGCTCTACAAGGCGCTCAACCTGCTGCTCACGCCGC
CGCTGAGCTCGTACGCAACCGTGCTCGACGTCTACTCGGTCTTCCTCACCAGCGACGGCGACGCACACGCGGACGCCGCGACGCCGCCCATCTGCGATAT
CTCCATCTTCCAGGTCAACGCGCACATGCTCAACAGCTAACGGTACCGTACTGCTAACGCTATCAAGTCAGCTTCACACACAAACTAGAAGGGCATCTAC
ATTAGGTTGTATGGTGGCTATTTGCTCTGTTTTTATATCTTCTGGGGGTTCCTAGGTTGAGCCTTGGTTGGTTAGTAACCTACCATGCTATGGCTTGCTC
TACAAGCCCATGGCGTAGCGCATGATCTGGTTCTTGAGCGGCTCGACGGCGTTGAGCGTGCCCATGCCGACGTTGCGCGCGACGCCCACAGCGTCCGGGG
CCGGGCCAAAGAGGCGCTTGAAGCCGTCCATGGCGAGCGCCATGCTCACGTTCGCGCGCTTGCGGTCGTTCTCGTACTGCGCCAGAAAGAACTCGCTCGA
GAGGTTCTCGCCGCTCTTGACGCCGTCCACGAGCAGGTCGCTGAGCGACTGGACGTCCGCGAGGCCCAGG