Description :
From Genome Similarity Track
Location :
Scaffold_33:97655- 99977
Sequence
2322 bases(100 bases per row)
AACCCACCCACTTTCGAAGATCCGTCTGGGATCGGAGCGTTGGCCATGCTGCAATGGCATGGACCTTGTCTGGGTCAGCCCGACCGTCCACGTTGTTGAT
GAAGCAGCCAAGAACCTTGATCTCTCGTGATGCGAAGATGCACTTGTTAATGTTGGTAAAGCGCTTGTTAGCTCGGACTAGGTCTAACACTCGGCGGAGG
TGGCTTAAATGCACCTCCATGTTCGTTTTGCCTCCCTCGACACGGCTATAGACGAAGATGTCGTCGAAGTACGCTTGTACGAAGGCACGTAGTGGCCTGA
ACAGCTACGTCACCAGACGGTTGAATGTCGCCGGGGCGTTCGATAAACCCTTTGGTATGCCGAGCTACTCCCAAAGCATGCCGCTTGGAGTGCTCACCGT
GTTAAGCGGGATGTCGCTAGGATCTGGTAGTATCCGCCTACCAAATCCAGCGCAATGTACAGTACGCTTCCGACCATGTTGTTCAACAACATATCATTTG
TGAAATTGGTGTCTGCTCCGGTACCGTCGCGTTGTTCAGCTTGTTACAAGCGTGACCTAGACACCACTTCCCGTTCGGCTTCCGGCCGCAGACGGTTGAC
GTCGAGTACAGGGACTTTGACTCCCGCATCATCCCTGCGCTCGCTTTCGAAGCGAAGAAGACATCGATGACCACGCACTGTTCGCGTGGAAGAGGGCATT
GTCTCCTGACACAGTGCTTTGTGCCAGGACCGAGATCGGTCTCACGCTGTACGCCTCGCTCCGGTAGGGGCTGGGTCGGTGGGGGTTTGGTCATCACATG
CACATACTCCGTCGCCAAAGCCTTTACCGGATCATTGGGGCTCATAAGGATCTCAATGCCCAGGCGCGTCTGACGTTGCTTATTCAGCTCCTACAGGGCG
TCCTCGTCCAATACAGAGAAGGAGTTCAGCTCCTCCCGAGTGGCTTCAGGTCTTATGAGCACCACCCTCAGCAACCTTTCCAGCCTTGAGGCTGGCCTGG
AAAGACCCGACTGTCAATTCCTCGAGATTCAGTATCTCTGCTACCTCTGACAGCGGTTCCATTTGGACACCAGATGTACACCGGTCTCGCCATCGAAGAT
GTGATAACACTCGTAAAAAGGCCGTGTAGTAGGAGCCAGGGCCCCGGCCTTCGAGTCGCTTGAAGCGACGTCGTCGTCGTCGTCGACGGCGCCCGTGACT
TGGAACTTTGCTACTCACGTCTGGGGATGCCGTAGCGCCGACATCCGAGGCACTCGAGGCCCCGTGATATACTATGTTACCCACACAGGAAGCACAACCC
GCGTCGCCGCCTTCGGTTATGGTCTAGGCGACCTTGTTTGGTACTGGGTTACCCACACAGTAAGCGTATCCGACGTCTTCCGCTTCTGTTAAGATCTGGA
GGATCATGTGTGGAGCTTTGTTTGTCACCTCGTACACGCTATTGCCAGCGTTCGTGACAGCTGTAGCTGTTTGCGGCACTTTGCCACCCGCTTGTGGACC
TACGTTACCCACTGGGTCAGCGCCTCCTAGCGCCGCCACCATCGAAGCGTCCTCGGAGTCGTCACATACGTCGACGACCCTCAAGCATCCGCTGGATGCT
TCGGTACCCTGGCAGCTCTTGAAGGCACCCCGTGTCCTGACAGAGGTAGGAACATGACTCACCAACGCTCTGTCAAACTTTGCAGGGCGGCTGGCACCGA
TTGCATTACCTCGCCAATTCGATCCAGCAATTGTCCTTCTCGAGCCGTGGCATGCCCAGGATCATATCGTAGGGATCAATGTTGAGAACAGTAAACTGTT
CTAGACTGTCAAAATCCTCAAACTTGACGGCCTGATCCACTTGGACGTTGGGGACAGTGACGACCTTCCCTCGGCCAGCTGCACTGACACCGTCCCGTTG
ACCTTGCTTTCCCTCAAAGCATCGGGCAACTTGTTGCTATTACGAGCCGCCGTCCGGCGGCGTGCGAAATTCTTCGACGCCTCAGAATCGATCAAAATTC
TAAACAGGTTATCGTATCCCCGCACACATTTGTGTACTACGAGCAGCCTGCCGTTACTCTTCGCCGATTTAAGAGTGTGAAGACTTTTAGGGGCTAAACC
CTCGTGGTGCTCGCCACCCGCGCACCCTTCGCGAAGACTTATCCCCCCCAGTAAGGCACCCCGCGCCTACTGGTCTCCGGCGTTTGCCTGTCCCCAGGAT
CCTGGCTTTTGCCAGCTCCCCTGAAGACGGGCTTGGGGAAAGTCCGCCTGTGGTGTCTCTCCGCGGGGGAGTCACGTTTGAAGTGGCCCAGCTTCCCGCA
GCCGAAGCATCAAATGTCGCGC