Description :
From Genome Similarity Track
Location :
Scaffold_29:976540- 980243
Sequence
3703 bases(100 bases per row)
ACTTGCACGCTTCCTCATTATTACGTGTAAGCTAGTAACGGACACTCTAGGCCCGTTACACCTGGTAGCACTTCGTAGTCCTTCCCATGACCAAGTTCAC
AATGAGCCGAGGCCAGACGTCTGAAGCTTCAGGGTCAACCCTGGAGCATGCTGCTTTCCCTCATCTCACTCGTGTTGAGTGGGAAGCCTTTCACCGCCTT
GCGGCGGTGTCCGGTGAGGCTGCTGTCGCGTCGCTGCTGAGCTCAGCGACTCCCGATCAACAACGTCAAGCAGCTCAAGAGTTCATGGAACGCGAGCTCG
CCGACGCGAATCGGCGAGCGACAACTCCCTCGCGTTCCTCGAAGAATGACATCGTCAAGTTGGAGACGTCAACCTACTCCGGTGAAGGAGCGAATCGCCT
TCCGTTGAATCGCTGGTTTCGCGAAATCGACATCGCTATCGCCTCGAGGATGATCGAGGCGCAAGGAGCGAAAGCTAACTTCTTACTTTCCCGACTGGCC
GGAAAATCCAAGGGGTGGGCACTCGGCAAACTGGGTCGTCAACAACGATGCGTTCTCCACCCTGGAGGCCCTCCAGAGTGATCTTCGTCTCGCCTTCGAG
CCTCTACAAGACGAGTCCCGAGTGCTTCTTCGCTCTGCGACAAGGCAAGATGACCATGCGCGACTACGTCCAGAAGACACGCCACCTCGCGTCCTGCATC
GTCACCAATCCGATTGACATGGCATCTCAAGTCCACGTCTTTGTGTTCGGCATGCGTGAAGGCATGGCGCGATACTTGAGCGGAACCCTCCTCTCTCGAG
GAGGCATTTGCTCTCGCACTTCGTGAAGACTACGTTGTGGCGGCGTCGTACGCGCGGGCAATGTCCGCGGAAGCTCAAGAGTCAGCTCCGGAGCCGATGG
AGATCGACGCGATTGACGCGTCGAACAACCGCCGTCGTGCAGTCCCTCGTGCGAATGGTGGTCGTCCCAGTCGATCCCTCACTTGCTTCCGCTGTCGGAA
GGTTGAACATCGCGCGGCTGAGTGCCGCGCGCCCGCGCCAGTACTCGCGCATACTGTCGATGCCTCTCCTACCGATCAGCCAAAAAAACGGCCAGGGCCA
GTAGGTGCGGGGCGCCCTACTGGCTGGAATGGAGGTCCGGGTCCCCCGGTGGCAACCCAACCTCCTAGCCCTCGCATGCTACACGCACACTTCAATGCCA
CCACAGCGTCGGGCGACTCAAGACTGATCATCATCAGCCTCCATGTCGCCGGCGCCCGACGTCCACTACGCGCGCTTGTGGACTCAGGAGTGACAAACAA
CTTCTTCCGTGAGTCGTGTCTGTCGACGCTACCCAGCGAAATCGCTGTCCGCAACGGTCGCGGACAGGTTGTAGTCAAGCTTTGACGGAAAGCCGCGCCC
CGTCGCGCGGCGCAAGATTACGTTGCCGTACACGCTCGACGGCTTTCGCAGCAATGACGACTTTCTCGTGATACAGATGAACTACGCATTTGATTGCATC
CTGGGCATCCCGTGGTTGTCACGGTATCAGCCAGAGATTGACTGGTTGGCACGCTCGGCTAAACACCGCAGCGGTTTCGACGTGAGCGAGGTGTTCACCC
ACCTCCTGGTTGCCCAGAAGGACTGGCCCACGTCATCGTCGTGGACGACCGGTCGTCCACGACGCAGGCTGTACACAGAGTGAGCGATGGCCCTCTCTGC
ACGGCTTGTGCAGTGCTGTTGCACGAAGTCTTCTCGCCGCGAGGCGAGGACAAGAACACGATGGTGGTCGAGCAGGGGCTCCCGCAATACGAGCAAGCGG
TCGAGCATGGGTTCCCGCAGCGCACAACTGCGGTCGAGCATGGGTTCCCGCGGCGCAACCACAGCGGTCGAGCATGAGTTCCCGCAGCACAATAAGGCGG
TCGAGCATGGGTTCCCGCAGCGCAACACAGCGGTCGAGCATGGGTTCCCGCAATGCAACACGGCGGTCGAGCAGTCGAGGCTCCCGTCACCCGAGCCAGT
GGTCGAGCAGTTGGAGCTCCCGCCGAACGATCACGCGGTCGAGCAGTGGCCCCCGCGTGTGACCGGCACAGTCGAGAGTGAGCTTCAGTGCCTAGAGCGG
GGTGATACATTGTCCAGCGAGAGCGATTCTTCCTCCTCGAGTACACACTCGAGGCGCCGGGCAAAGAAGTCGAAGCGCCGTCGTTTGAAGCCACGACGTG
AAGCTGCACCGAACGGCATCTCACAGACGGAGTCGGTCTGTGTCAATGAGCACGTGGACGACGGCATGGGCCGTCAGCGCACCGTCGATCTTGCGTGTCC
AGACGCTCAATCGATCACCCGGCTTCCAGGTCTCTCCTGGAAGAACTTCCTTCGTGGTCTCAAGGTTGGCGAGGTTGAGCAGGTCTGCCTAATCACAGAC
ACTTTGTCTACGCCACCTCGAAGGGAACACCGTCAGTGATGACGACGGATCCACCCGTCCCAAGAGCGCCGAACTGAAGTCCGCTCGCGAGGAGCGATTC
CCAGCGCAGTCCTGGGAGTCCTTGCGCGAGTCTGGTAATCCAGTGTACGAGACCGTCCGCGAATACGCGGACGTCTTCCCCGATAAGATTCCAGCCGAAC
TGCCTGCCGATCGAGGCGTCCGCCACGAGATCGATCTCGCGCCTGGTTCGAAGTACTGTGTGACGGCAGTGGCCGCTGCCGCGAGACCAAGTCAAGGCCA
TCGACGACTTCTTCGAGAATCGCCGTAAAGCGGGTCACGTGCGTGAGCGTGTCTCTCCACATTCGAGCCCAACGTTCTGTGTGAAGAAGGCTACAGGCAG
ATGGCGCATCGTTCATGCCTTTAACAAGTTGAATGATGCGACCATTGCCGCGCAAACCCCAATTCCCCGGAAGGACATGGTGCTCGACACCATGGCGGGC
AGTGTCGTCTTCAGCGCCATCGACTTGACCGACGGATTCTATCAGATCTTGATGAGACCGAGCGACATTCCGCTGACAGCGGTCAGCACCCCCAGCGGTA
TGCTCTGGGAGTGGCTTGTGATGCCACAAGGCTTGAAGAATGCTCCCGCCACGTTCAATCGCATGGTCTCCCATGTGCTGCGTCCGCTTCGAGACTTCGC
ACCGAGCTACTTCGACGACATCTTCATGTACAGCCGCGCTGAGGGTGGTCTCAGCGCGATAGAAGTCCACTTGAAGCACTTAAAACAGGTCTTCCAAGTG
ATGCGCGAGAACAAGTTGTACGCGAACCTGAAGAAGTGTATCCTTTGCGCGCCGGAGATTCCGGTGCTGGGCTGTTTCGTGGGCAAGGACGGCGTTCGCG
CCGACCCGGAGAAGGTGTCCTCTATCAGACACCAAAGAACCCCACTGAGTTGCGTCAGTGGTTGGGACTGGCAAAGTATCTCCACAAGTACACGAGGAAT
TACGCCGGACTGATCCAGCCCCTCTCATCACTCCTGAAGAAAGATGCCACATGAGTCTGGTCACCCGCGCACCAAGCCGCCTTCGACTCAGTGAAGAAGA
GCCTTGCTGAGGCGCCGATCCTAGCTCTTCCCGACGACTCGAAACCATATCACGTCGTTTGCGACGCGAGCGACTTTGCCATCGGCTGTGCGCTGATGCA
GTTTGACGACGAAGGTCGTGAACGGGTCGTCAGCTATCAGTCTCGACAGATGAAACCAGCGGAGCGCAGCTATCCTGTCCACGACAAGGAGCTTCTCGCG
ATG