Description :
From Genome Similarity Track
Location :
Scaffold_612:9765- 11633
Transcript NameFunction/comments
g13953.t1hypothetical protein

Sequence
1868 bases(100 bases per row)
GGAACGCTTCGACGAGCAAGGCTGGGACTCGCTCAAGGCGAGCCCCTTTTACAAGGTCTTGCGTGAGTACAAGGATGTACTCCCGGACGACATTCCTGCG
GAGCTACCGCAGGATAAGAGTGTTCAGCACGAGATTGATCTCGTGCCGGGAACGAAGTACTGCGTCACGCGACAGTGGCCACTGCCGCGTGAGCAAGTCA
AGGCAATCGACGACTTCTTTGAAAGTCGTCGCAATGCAGGACAAGTGCGGGAATCGAAGTCCCCGCACAGCGCGCCTACGTTCTGTGTGAAGAAACCACA
GGGCGGGTGGCGCATCGTTCATGCGTACAACAAGCTGAACGATGCGACGGTACCGGCGCAAACGCCGATACCTCGAAAAGATGTGATCATCGATTCGATG
ACCTCGAGTACTATCTTCAGTACTCTGGATCTGAGAGACGGGTTCTATCAGATCCCCATGCGTGAGAGTGATATCCCTCTCACAGCGGTAAGCACTCCGA
GCGGCATGCTCTGGGAGTGGCTCGTAATGCCGCAGGGGCTGAAGAACGCCCCAGCGACGTTCAACAGGTGCGTCACGCACTTGTTGCGCCCGGCGCGCGA
CTTCGCACCGAGCTATTTCGATGACGTGTTCATTCACAGCCGGGCTGTGAATGGTAAATCGGATGTGGAGATGCATACAGAGCATCTCCGCAAGTTGCTT
GAGCTCATGCGAAAGCACAAGCTCTACGCGAACCTGAAGAAGTGTATCTTCGGGGCGACCGAGATACCCGTACTTGGGTGTCTCGTGGGGGAAAACGGCG
TACGCCCTGACCCAGGAAAGGTCAGAGTGATCAAGGAATGGCCTACGCCTTCAAACGTAAAGGAACTGCGGCAGTTCCTTGGACTCGCCACGTACTTGTG
CAAGTACGTGAGAAACTACGCGGGCAAGATTCGCCCGCTGTTGCAGCTCTTGAAGAAAGATGCTGCATGGGAATGGACTGCTGATTGTCAGCAGGCCTTT
GAAGCAGTCAAGCAGGGCTTGACTGAGGCGCCGATCTTGGCGGTGGCCGACCAAGATCGCCCATTTCACGTTGTGTGCGATGCATCCGATTTCGCGATCG
GATGCGCACTGATGCAACTCAATCACGAAGGTCGTGATCGTGTGGTTTACTACCAATCGCGTCAGCTGAAGCCAGCTGAGCGCAATTACCCGGTACATGA
CAAGGAACTCCTTGCCATGAAGTATGCAGTCGCAAAGTTTCGAGTGTATCTACTTGGGAGTAGACCATTCGTGGTCTACACCGACCACGCATCGTTGCGT
ACGACGATCAAGTCGCCGCACATATCACAAAGAATGGCACGGTGGCTGTCATTCTTTGCTGAATACAACTTCCAGGTTGAGTACAAACCTGGAAGGTTGA
ATGTCGTGGCCGACGCGCTTTCGCGTCGACCAGATTATGCGGTGCAAGAGACCGACGCCAACGCAGTTGGCGTCGTCAGGACGACTACACCCTCGTCGTC
CTTGTTGGACGACGTGAAGGCCGCATACACACATGACGCGGATGCGAAGCAGTTGTTGGAGTACTTCTCCACACCTTCTGACAAGTCTCGTCAGAAGCTG
GCCAAACAACTTCGTGCCCGTGTACACCGTTATCGTGTACACAATGGTCTGCTGCTTTACAGCGCAGTTGACGACAACGCAGATCGCATTGTCGTGCCGG
ATGATCATGAGCTGAAGCTCAAGATCACGTATGAGTACCACGATGCCCCGACATCGGGACATCATGGCCGTGAGAAGACATATTTGCTTCTCACGCGTGA
CTTCTATTGGAGTCACCAGTACAAGTGGGTACGCAAGTACGTTCGTGCTTGCGAGGTATGCCAGCGTG