Description :
From Genome Similarity Track
Location :
Scaffold_590:9763- 18013
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_590-snap-gene-0.9ATPase AAA-2
Pytul_var.sporangiiferummaker-pug3_contig_590-snap-gene-0.10Conserved gene of unknown function

Sequence
8250 bases(100 bases per row)
GTGGTGTAGTGGCGCATATCCATGCGTGCTGCTGCTTATTTCTAACGGTGTTGCATCTCCCATGTGGTTGTTTGTTTAATTGTTGTGCGTTTATAGGGGA
AGTTCCGGAGAGCATCAAGAACAAACGTGTCGTGTCACTGGACCTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNTGTGGACGAGAGCCGCGGCGAAGTCATTCTCTTCATCGACGAACTGCACACCCTTGTGGGTGCCGGCGGCAGTNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNCAGCCAATATGCTCAAGCCTGCGCTCGCACGAGGCACGTTGCACTGCATGGGCGCGACGACGCTGGATGAATACCG
CAAGTACATTGAGAAAGATGCAGCATTGGCGCGGCGGTTCCAGTCGGTGCTCGNNNNNNNNNNNNNCGAGCGTCGAAGACTCGATCACAATCCTGCGCGG
CCTCAAGGAAAAGTACGAAGTGCACCATGGTGTTCGCATCACGGACAATGCGCTGGTCGCTGCAGCGACACTCGCGAATCGGTACCTGACGGAACGCAAG
ATGCCGGACAAAGCGATTGACTTGATGGACGAAGCGGCGTCCCGTCTTCGATTACAACAGGAGAGCAAACCCGAACCGATCGACAAACTCGACCGTGAGA
TCATCCTGCGCCGCATTGAGATTGAAGCCTTGCGCAAAGAAACGGATGCTGCTTCCAAGAAGCGCATGGCGCAATTGGAGAAAGAGGTTGAGAGTGCATC
GCAAGAGTTGAAGGTGCTCATGGACGAGTGGAACGCCGAGAAAGAAAAGCTAGAGGCAATGCAAGATGCAAAGCGGAAGCTCGAAGAAGCGCGGCGCGAG
CTCACGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCGTGCCGGTGAGCTCTTGCATGCGATTATTCCGAAACTCGAATTGCTGGTCGCA
GAAGAAGAAAAGGAGAAAGAGGCGTCTGCAAGTGGTGCGGCCGGTCCGATTGACGATGAGCACAAGAAAGTGAAGTCGATCTTGAGCGATGCAGTCACTG
CGGACCACGTTGCCGAAGTCGTCGCGCAGGCAACGGGTATCCCAGCNNNNNNNNNNNNNNNNNNGCGAGAAGCAGCGCTTGCTGAAGATGGAAGACTACC
TCAACCACCGCGTGATCGGACAGAGTGAGGCGGTGCAGGCAGTGAGCAACTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNACCGGCGTGGGGAAAACGGAACTCACTAAGTCATTGTCAGAGTTTTTGTTCCAGACCCCGCAGGCTCTGACG
CGCATCGATATGTCCGAGTACATGGAGAAGTTCAGCGTGAGTCGACTAGTTGGCGCGCCTCCAGGATACATTGGGTACGAAGAAGGCGGTACGCTAACGG
AAGCCGTGCGCCGCCGTCCGTATCAAGTCGTGCTGTTTGACGAATTCGAGAAAGCGCATCGCGATGTGTCTAATATCCTGTTGCAGGTGCTCGACGAAGG
TCGACTCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACACGGTGATCATCTTGACGAGCAACTTGGGTTCTGATATCC
TTGCGGGTCTACCTGAAGGGATGCCGAGCTCCGTCGCAGAGACCGAGGTGCTCAGTGTCGTGCGTGGCCACTACGCACCGGAATTCCTGAACCGCATCGA
TGAGCTCGTGCTTTTCAACCGTTTGGACCGGGAAGCAACGCGCTCGATCGTGGACCTGCAGTTGGAGCAAGTAGACAAACTCTTGGAAGAGAAAGAGATT
CAAGTGGAGATCGATCCCGAGGCCAAGGAGTGGCTCGCGGCCGCGGGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGCGCGTCCGCTCAAGC
GGCTGATTCAGCATGAACTCCTCAACCCAATGGCAGTCAAGCTGCTCGAGGGATCCGTGGGTGCAGGCCAGACGATGCGCGTGCGAATGAATCCCAACTA
TGAGGAAGAGCTCGTGAAGGAGCCTCGTCGCGCGAGACCGCTGCGCATCGACTAAGATAAGCTGGTTTGAAGCATCGAGCATGTTACGTGCAGTTATTTT
TTTATTTTGAGTAGGCAAATGGCCAAGAGCCATGAAGGCTTCAAGCAACAAGAAAATTAAAAGGTTCAATTACGACGTTTGCCTTATAGTAAAATCCAAG
CTATCTATATCTATTGTATCTCTCTATCTGTACATTTTCTTGTACATATCTCCCCCTTCGTCATATATAATCTCTACATCTGCGATCAGCTGTGGCGCGT
GGTCGTGCGTCTCCAGACCTCGGAGCGGAACTGCTGGGCATCACTCAGTGACTTGGTCGCGTTGTTATCGTGGGGCTCGTGCTGCGCAGACGAGCGCTGG
GTCATCAGGAACGCAGGCTCAGCATCGTTTGCGGTCATTAACGCTGCGAGAATCCTGGCTCGTGGATTCAAGNNNNNNNNNNNNNNNNNNNNNNNNNGAA
CAACGGAATCGCAGGCGCGAGCTCCGAGATTCAGCTGTGATGGTTTCGCTACAAGGGACTCGACAGCGGCTTCAACTAGTGCCTGTATCCGTCGAACAGC
AACGTCCTCCTGCGTTTCGGTGCGCGCAGATCGCTCCTTGGAGGACAAACACGTCGCGACGCTGAGCAACGCGATGAACGCATCAGTGAATCCAGCCACG
CTGCCCTCGAGCGCCTGGGTCTTTGGAACTTGGGTTCTTTCGCTGTCCATCCACTCGGCTACGACGACTTCGTCGCTGAAGCGCGTGAGCACACGGAGAC
ACGACGTGGTCACACGCCACGTCGCATCCCAAACCGGCAGGTCGTGGTTACTGCCGCCACGGTCTTGTTCCAGACGCTCATCTGCACGCTGCAGCGCGCG
CAAACGGGATGCAAAGGTCTTCAGGTGGCGTGCCACGGACACGTGCACCTTGGTCCAGTCTTCCATCGCAAGTGGCGCCTTTTCACNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNTCGACTTCGACTCAGTTTGAAGACCTGCGCACTCACGTGCTTCAACGCAAATATTTCCTCTTCGCGGGAGTCTTCGACGCC
GGCGTGTTCGTCAAACATGCTCGAGAGCGTGCGCACGACATTCCCGTCGTCTTCGTCCCCACTACTCGTGTGTTCCTGGTCGCGCCCAGATGCGTTTGCT
GCTGCTGCCGCCGACTTGAACGCCGTTTCCTTCAAAATCGCTTTCTTGCGGAGCGCGAGCCGCTTCGTGANNNNNNNNNNGACAGCTCTTTGGAATCAGG
TTGTTGGTCACGCCGCGGGTGCGATTCAGTGCGACCAGTAGCACCGACTGCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNA
ATGGCGGGATCGATGCACGCACGTGGTCGTTGCACAATCGCGTTGTTTCCTGGAGCGAGCGAACGACGGTCTCCTGAATGGTGCGAAACACGCGGCTTTC
AAGCAGTTGAAGGAATACGATTGTAGTGGCCTCGAGCTCCGTCGAGGTGACCGAGGACGAAGAGGATGATAGTGAAGATCCTTGCGGCGAAGCGAGCCCA
CTGTCCTTGACACAGGAATTCACAAACGCGTCGGCGCTCGGGATCGCGACTTGCTGGACAACGTGCTCGCAAATATTTGTCGCGACAACTTCGACGACGA
ATTCAACCACTTTTTTCAAGTTCGGGTGGATCTTGAAAATGGATTCGGAGAGTCTATCATCGTCCGTGAGACTCGTCGCGGTGCTCGACATCGTAGCGTC
CGCTGTCGTGTCGTTGTGTTCGTCTTCCGTGATCACCTGAAGCGGTCGAAGTTTACGGATCGCAGTGAGCTGGCTAGCGCCAGACAGTGGAGCGCCACTT
GCTGTAGCGCGCTTCGTCACACGGTGCGATGGCTTTGCGCGCGTCTGAATGAACCCGCGGAGGTCTTCCAGCTCATTCACGCAGCTTTGCACAAACACTT
GACTGTATAGGAACGGCAGATTGTCTTCCCCACTCTGGGCGCTTGATTCGACTTCCTCGAGAATCAGCAAGAGTTTACTTGACGGCAGGAGAGACGGCGA
CCGGAATTCCGCGTCGTCCATGAAGCCAGCAATGTCGAGCTCCAGCACATGGAACACGCGCTCAATCTGCATGCCAATGTACAATCCAGTTTCCCCGAGA
CCATCTAATCGCGAGGAATGGTAGATGCGTTCCAAGAGGACAAGCAGCTGCTTAAAGTAGGTCGTCGCAGTGGAGAGCTTGTCTAAGGACAACATTGTTA
GATAATCGCATAGCCACGGTACGCACTTGGATATCGTCGACTCGATGATGCTTTGCTCCAGGAGCAATTTCACGTCGAGACCCAACGTGTCACTCGTATT
CTCGAGGGTCCCCACCGCTTCTTTCTCGGCGGCTTTGAAAGCTGGATTCTGCTTCGAGAGCTGCACAAGCGATGATGAATTATGCCACTGCGGCGAAAAG
CGGAGGTAACCGAGAAACTTCGCCACCACTTTGAGCTTCAGCACCGTCTCTGTGAACGTTTTCCGTGGATCTGCATTGATGGTTTCCTTCCAGATCGACT
GGAACTGGAACTCCAGTTGGTACTTGACTAGTTGGGAGAACTCGTAGCTGTCGCAGCTGTGCAGAAAGTGGAAAAAGAATTGCTGGTTCTCGGCGAAATG
CTGTCGTGTATTCTCAAACGTGGTCGTGATTGCAGTGTTCCCTCCATTTGTTGCTGTCCCGGCTGTAGGACCCCCAGTACTCCGTGACTCGGGTCGATCC
GCTTTCCACGAGCTCGTAGTATTGCCGCCACTGGGCTTGTTTGGTACGGTCGATCCAAAATGGTTACTCGCCGTGCTGGAGCCTGATGGTCCTTGGTTTC
CATTTGAGCTTGTGGGCGCCTTGTTGGATTGCTTTTGACTCGTAAATCGCCGATGCAGCTTCCGCAGACGATCTGGATTCTTCACGACAAGCTTGTCCTC
CATGATCTTGAGAACCAGATCTTTGTCACTCTCGCCGAACGGGTTGGAGCCCACCTGGAGAAGCTCCATGACAAAGAACTTTGCGAACCACCACCGGTTC
TCCGGGGCGACTTCTCCAAACAGCTTCCTCGCATTGTCAATCGCCGCTGCCGCAACACTGGCATTTTCAATGCCGACAAGACTGTGCTGCTGCTTCTGAA
ACTGGCGCAGCAGATTGAGAAACCCATCGCGGATTTTTTCGCGGTTCGAGTACATGACAGACTCGGTCGGGGACCGGTAGTGCAGTCGCGAGTCGATCTC
CTCGCAGAAGGGTAATGCGAAATCCCGCACGGCACTGGCTGCAGATTACATCCGGCAGTTGCACCACACGATCACATACAAAACCACACAATAGAAGCGT
TAGTACTACAAACACAGAGTTGCCACTCGAAAAAATGAGGCGCGTTGCACATGTCTTACCTTTGGTTTCAATGGGAAGTTTGCACCCGATCCGCGCACTT
TCTTCGACGCGGAGCTCTTCACGTCGCTGCGCAAAGTGCTGCAGTCGCGCCAGCATTTCTGCGCAGATGCCAGCGTCCGCCAAGCTGCGCATGAGCAACC
GGAGCAAGTCAGTACNNNNNNNNNNNNNNNNNNNNNNNNNGCTTGTTAACGTCGCCTCGATGCCATTAAATACCAGTGCGGCAAAGCTCAGGCAGTGACT
GCGCCAGCAAAACTCGTTTGTGAACCCGCAAGTAGACACGCTCTCGGGCGATGACTCACCGCTGGAACTGCTACCGGTACAATCTGAGCGAAACAGCAGG
CTGATCAGCAACTGCAGCTCTGTGTACGTACTCCCCACGAATCGCTTGCGGATAAGGAAGCCATAGAGTTTCGCTGCTTGAGCGTTAATCTGGAAATCAT
CGGCGCATTTCTTCTCATCTTGGAGTTGCGAATGTGGAGAAGGCTCTTGCAGTGGCACAGGGCTGCTTTCAGTGTTGTTTGGGAGCAGCGATTGACGCCG
AGGACGTTTCTGCTTGACGCATAGCGGCGTCGGAGGCGGCTTGGCCGCATTCTTCACTGGCGTCACCATCGGACTGTTGCATTCAGTAGCAGCAACATTG
CTCGCAGGTGCTCGACGCTGCGCAGCAACCCCTGCAAAAGGTAACACTCTTTTCGGTCCACCTGGAGGACTATCATCGAAGAGCGGCTGCTGCATTGGGA
TCTTTGCCGCACTTGAGATCCGCGTCTCCGCCGACTTGTTGCCGAGGTGTTGCTGCTCCCAAGGCTTTGATGGAGGCGTAGACTCTAAAGCAGACCCAAA
GCCATCTGAGCCTTCAGCAGACGGCATCATTCGTCGCTCGAGGAGCTCTCGTTTGGCCCACGGATTATTTGACTGGATTGCCGGATCAGATCCACCCAGT
GGCGGAAATGCAACTGGGTTCAACACTGGTCGTGTGATCACATTTTGGTCTGAGACCAGTGTTGTCGTGATGCGTCTCTTCGCTGCTTTCACGGCGGGTC
TCTGGACTGCCGGAGACGTGCCGCTGGTTGTCTTTGCTGGCGCAGATCCTCGAATCAGCGATGGAAAATCGTTGCTTTGAAGAGCGAACGGCAATTGTTG
GTTGGTGCCACCGCTCTTGGTCAGTTTCGCAGCGCGCAATGTCTTGGCATTGCTTTCTTTAGCTTTTGTGACAGTGGCATTGGCGCTACTGCTCGCATCC
GCGGCTGGAATTGCACTGGCACTGGTGGCCGCATCACTGGTCGCTTGTTGGGAGTGCACGACATGGTGCAACTCGCTGAGAAACACGTGAATCAGATCAC
TTGGTGCCCATTGCGTGGTTCTCGATCGCATCGCCATGGTCTTGCTCTTGCTGCGGACATCGTTGTCTGCCTGATTGTCTAGGTTGGTGTCCTGTTCTCC
CTTGTCGGTGTCATCGATGAGCGTGAGTGGAATGCGCACTGCTGCTGGCGTGTCGTTTCGGTCGCCTGGCGCGAGTCGCGAGGCGCTCCGAGAGACCAGC
AGCAGGTGCTGCATGCGCTCGTGCTCGTCGTCCGAGAGGCGGCGGATGGCCTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGTCGTCTGCGTC
GATAGCATCCGTCGTCATCGCACAGACGCTCCTGGTTCTTCTGCCGCGTACTTCTTCTTTCGACTGGAGCTCCTGGCCGCATCGCCCATGTCGATATTTT
TTGTTGACGGTTTAGTGCGGGAAGTTTTGGCGCCAAAAAGGGAAACGCCACCTGATTTTGTTAATTTGATAGATTTGAAAAGCAACACAACACATGGTCT
CTTTATCTTGATACTACACAAAAAGGGTAAGCAAAATGTGGAGCGCTCCAGAAAGCGTCTCACACAGTTGCACTGTGGGATGCAAGCCATTTGTGTGCGA
TGGTGGCTCGTTTTTGCGCTCGGTCGCACCAATAGCGAGCTGGGTTATTTTGCTGGTTCAAACGTGCCCAGCTGGCGCTTTACTTGCTTGCTGTTGTTGT
GGAACGACCGAGCATCCTTTAAAATACCCGCAATTTATTAACACTCGACTGTAGATAACAGGGAGAAAAGCCGCTTGGTGGGACAATGCGTTGCACATGT
GCGTCGGGCCAACTACAAACACGAGAACGCGCGACACTGGAACTGGCACGGAACGTTAAAACGACTCCAGTATCTTTCTTTCCAGTATATGAAAATGTAT
ACTGTAAGGCTGCCCCGTAATGGTGTCGTCACTTTGTCGCCGGTCGTGGCGTCGTCGAATTCCAGATTCTGTCCAATCGGTGCGCTTCCTGCGTCTCCCT
CGCTGTTGTATCAACTTGCTCCCAATTGGTACCGAATCGCCACAGCGTGGATACTTTGCCGAGTGTCCACAGAACCTACTGTACTGTACCATCACAGGAA
AGCCATCTCCGCAAATGAAACCTGGAGTTTTGAGCTGTTCAAGAATGTGGTTCACGTGGGTAGGGCAAGAGCCAGCCCGCTTGCCCACCACCCCATACAA
ACGCCAAGTGATCTGACGTACGGACAAAACAAAAACAGCAAAACGTAGCTAGGGCTCGGGTCGGCAAACGGTTGCGTGGGTAATAAGGTGCTGCTGGCGA
TTGGCCGTTCCAAGGGACCGAGGAGGCATCCATTTTCCCCCATTCCCCCC