Description :
From Genome Similarity Track
Location :
Scaffold_6:976257- 982177
Sequence
5920 bases(100 bases per row)
CGAGACACCCAAGGACGGGTATCTCGCTCGCCCCGAAGATACATTTTTTCAGGTTCGCATAGAGCTTATGCTTACGCATAAGCCCTAGCCGCTGACGGAG
GTGCTCTTTGTGCACGTCAACGTCGGCCTTTTCTTTCACAGCCCGGCTGTGAACGAACACGTCGTCGAAGTAGCTTGGTGCGAAGTCACGCACTGAGCGC
AATAGACGTGTGACACATGTCATGAGATACACCAATGGTTACATCTGACAGACTATTAGTCTACAGGCATTTAGGGATTCATTGGTTGAAAGTCAACATC
TTCAACCAATTAGAATTGTAGGATTCTATCAATCATTCTTTGGCAAATACCTTCCATTTAGAATATTTGATTGGGAGGAAAACCCAAATAAAAACAAATT
AACAACTCTCAATTTTTCCGGAAATCGGCTTGCTTTCCTATTTAAGTAAATATATACTTTCGAACGAAAGTATAGCTAATCTAAGTAAAATGCACCTAAT
GCTTCCACGCACGCTAATGTAAAAGTAGGCCCATTACAGTCTCGGTCTATTTTTTAATCCCTCTTTTTTTAATACTGACTTTGAAAACTCGGAATGGTCG
GCGGTGGATATACCCATGTAGGGTTACCGTGCAGTCGTCGTTCACGCATTCACCGTCTCTGTAACATGTAAGTAAAGTACTGTACGTGCAAAACATCAGG
TGGATAAATCACGCTTCACGCAATCTCTAGCTGCTACAGAGTATACATCCTAAAACCTAGACGATTTATACAAAACTACGGTAAGGCATTAACTTCAACA
TGTATTAATTCTGCCGAAATGTTACTGTCCGCGTCGTTACCTTTCATTAGTAGGAATTCCTACCACAACCTTGAGTTCTTCTATTAAATAATTTAAAAAA
AGATTTTTGAGATCTGCAAAATAGCGCCAGGAATCTTACCTCTCAAAATAAATTCAAAGAGCACGATTGAAATTTACAAGTTTATCGGGGATCCCTAGTG
TTGGATACGATCAATGCTTACTACTCAGTGAGATTTGTAGAAAAGTGTTTGGTTTTAACAATATACTGAACAAATCAATTTCCGGGTTTAAATTAATGAC
CTATCTGAAATTTACTTCTTTTTCTGAAACAACATTATAACAACATTTGTATTATCCAATTAAAACCAGCGTACAAAAAGTAAAAAAGCAAATCAGCGTT
CAGTCGTAGAAAATATCTGAATGGACGAAGCGGACACGAAGACTCGTCGCTCCTGAAATGTGAATGCGCTCCCTGCGGGCGATGTCCAACTCGAACATGG
CATAGTAAAGTTTGCGAAAGAAGAAGGTACCCAAGACCCGCAAGGTTATTAACTTGTAGTCATACACCCGCAATAAGAATAAGTATTTAACAAGCCCTTC
AAGCAGCGGTTGTTCGACCGGTTTTACATCCTTGGGGGTACGTTTATATTTTAAGATATTATAGCTATTATTATATTCTTTTTTAAGTAAATGAAAAATT
TATTTTTAATTTGGTACAAATAAATGTAAAATATGTAGTCGCCAGAGATAAGCTTGTAAAACAGAGTGACATGCCTCTGCTTATTGAGGCTATGGAGGGA
AAAAAAAGTAGGAGGTGGAGCCAAGCTCGAGCCTAGTTCAAGGCATTAGTAAAGACCCGAGCCTATTTGCGTTCCGTCTAAAGGTTTTTTACGGGACGAT
GAAAAACCTCTACTCTCCTGGTCCCATCAATGGTTTCATGGTCCCAGTTTTACAAGGCCGTCATGTTCGCGCTTCGCCCGAGAAGATACCGCCAGATGTG
TACAAATTTAAAACTCCTCGGCCGAGTTATACAGTTTTAAGTTTGAAACGACAACGGCATTCAATCGTTTGAAGATCCAACTAAGGGCTGATGTGAAAGA
TGTCTTTCGGTAGGTGTTAGTGACTAGCTGTCAGATGCAGAATACAGTAGTGAGAAACGTTGAATTCATCGGGCTCTATTTGAAAAGGCTAAAGGTGCAC
CCGCTTTTGAGTCTCTCCAAGAGAGACTGCGAGCGTACCACAAGCGAGTAGAGAAGTATCTGGCCTTGGTTTCCCCTCATGAAGCCAGTTAAAATAAGAT
ACAAGAGAAGGTACAAGCAGCGCGAGATGAGGAACCCGCCAAGCTCGAAACGCCGATAGCGGATTTTGAGGGTAAAGGTACATGCACGCCTTTCGAAGAA
GCTTTAGGAAACTGAGATAAAGCGCTGGACCCAATCGCTTCCCGATAATGAATAGGGAGTCAGTAGCATCTCTTAACCCTGATAAATTCTACGATTTTGC
ATCAGTAAAATGCGTCTAGGTACACTGAAATGTGCGAGCTTATACCAAAACAAATAGCTCACACGAAATTGTACGATGGATTCATACTAATAAGTACGAA
TTCAAAACAAAAAGTGCGGAAAAGGCAGGCTAAAACATACAAGTTCATGCCAAATCCGCGATTAGCTTGTGGATTTCTGCTTACAAAGAGGTTGAGTCCT
CAGGCAGATTCTCCGCAAGCCGAGGCTTGTCAATACGCTTCTTGCGGACCTTTCTAATGGAGATTGGGATCGACATGCATGACTTCGAAGCGTTACCGCT
TGATGTAGTAGTTACGAAATCCAGATAGGCCATGCTCCTTCCATTGCGACTGGTCAGTTTCCCCAAGCCCTGTGGCGAATAGCCCTAAGTCCTCATCCAG
CATTTTAGCCACGCTTAATTAGCTCTTCTTAATTCCAGCTGCTGCATGCGCCGCCGGTGACCGATTTGACATTGGTATAGATAGGTGTAGCGGAAATCCA
CCACATCAAACAAACGTGAACCCAGTTTTTAACTACTGGGATTTCTGATGTTGTTCAGAGAACTTGTGTTTGCTCTTCCTCCTCAACTTCTGCAGATACA
CCTTCCCTTCGTCCTGCGGTAGCCTGTTGCTTGAACTTGCTAGGTCGCTGATTTGCGCTTTCATTTCCAGTTCCTGTGTTTCAAGACGGCGCAGCTGTTT
TAGGACAGATCCTTCTTCAGTATTATTGGGGGCCTTAAAAGGAGCACTATGACATCCGTGTCAGATTGGTACTAGGTACCGTTCAAGTATGTCTTGTCCG
GCGCCAAATAGTCAGCTTGCTCACTTTCCTTCGATTGGATGGTGACGTCGAAAAGCAGCTGACTCAGCAAAACTCCACCCGGTCCGCCACTTAATCATAC
GCAGCGACCAGTGACGACCAGGCTGCGCATACATGAAGTGGTATTAGGCACCCGCATGGCGAAATGTGTGTGAGGTAATAATTGTTAGTTCAGTGCTTCG
TGACATATGCCCCGCACGATGCAGTTGACCAAGGCGATGAAGACCTGCTCAGACATCTTCTTTTCCCAACCAACGCGCACCCTTTTACAGCCTGTAGTTG
GATATTGGGTCTTGCGTACCTTCTTGCGGATCAAATGCTGGAAACACGAAATCCTCGTCACCCCACTGATGTATTTTCCTCTCTGAAGCGTAGTCCACCC
AGTTACGCATGTGCTTTATGCGTTGAGAGCAAGTTCATCGTTGTAACGGGGTTACATGGTGTGGAACCCACAGGGGTACGAAGTACCCGGAGAGTTAACA
AACTCTAAGTACATAAGTTGGAGAGCTAACAAGGTCTCTCTGTACGTGGCTGAAAGCCACACGTTATGCATTTGATTAGGTTTAACTATGCTAGATAGTT
AAACAGATACATTTACCCCTAGGCGGCTTGGCCGCAATAATAGTATATAAAGCACTTCTGGTTTAAAGCATGGAGTTACGTTATTAACGTTGAGCCCTGG
TCGTGGGCTGTAAGTGTCCTTTGGATAAGAAACTTAGTATTAGTGACTCTTTGAGTCGAACGTCTTCCTCTGACGCTAAAGCAACGGCAGCCCCGCTGCA
CTTGGTAGCACGTGTAGTCAATCCCGCTCCTGAGTCGGCTGACTATATCCTCTGCGAGGATGGAACACCCCGTGTTCGCAAATTTGTCCCCGGCGCAGCA
GGACGCGCTTACTAAGCTTATGTCCTTGCTTGGCCCGGAGGGCGTGGCTCGTCTCACATCGCAAGGTCCAGAGGCGGTCACCGCCAGGCTGGAATCGTTC
TCACGCTACGAGAACGCGCTCTTGGAGCACGTCCAAGAGAAGATGAGCGCCGCAACAGCGGCGGGGTCGATGACGCGTGAATCGTCTATGAGGCTGAAAC
CGCTCATGGTGATCGTAAAAACGTTCGAGGGCAAGGATGGAGAGAATCTCCTTCTCTGGACCCGTGAGGTCGAGATGGCCATGGGATCAGCCCTGCTCCA
GTCTGAGCATCAGCGCGTGGCGCTGGCTATCTCCGGGCTTGAAGGTCGCGCTCGCGAATGGGCGCTAACATGCAGCACGTCTATTGACACTGCATTTCCC
ACTTGGGATCAGCTGAGGCAACAGCTTTCGCGCGTGTTCGCGCCGCCTAATCAGGCGTACTGTATCCGGTCGAAGCTCCTTGCTACCCATTAAGGTAAGA
AGAAGTTATTGAACTATGTCCAAGAGTTGAGAACTCTTATCGCCGGAAATGGCGGCGGACCCTCTTCCAGAACTGGCCAGCGTGACCGTGTTCATGGAGG
GACCTCGTGTGAGCGCAGCTCGAACGGAAGTGTTCCGTGTACACCCTAACGCTTTCGAAGAGGAGGTGAATGTCGCATTGAATGCCAAGCACAACTTCAG
GTCGGCTCGACATGGTTGGAGCGCTGGTAGCGCAAGCTCTTCGAGCGGTTCGGAGCCGATGGACCTCAGCTATGCTGAAGACGAAGAAGCGGAGCTTCTT
GCTGCGGAGCAGCGCGCCGGCATCTGCCGATGCTTTGGGTGCAATAGCACTAAGCACTTGAGGGCCTATTGCCCTCTGTGCAAGAAGCGCGGGGCTCCGG
CGAGCCAACCCTCCGGGTCATCGCCGGGAAACGGCAATTCCCCGTAGACGCGGGGCGGCCTACTGGGGAAGAACTGAGTTCTGTTGTGCCTCGAGGGGGT
AGAGGCCAACAAGGCTCAGCCCCGAAGAGAGCTGTGCTCTCTTACGAAAAGGGTGTGTGCAAGCCGGGCTTGCTGGTCGTTCAAGTGAACGTGAAGGGCT
TTGCAAAGCCATGGAGAGTCTTGATTGACTCGGGAGCCTCGGGCAACTACGCCCGTCGCTCCACCCTGGAAGGGAGTCAGCTGTATGCTGAGGCACTGGA
AGTGCCAACGAGAGATACGATCTTTGTCCGTCTCGCGACGGGGGACACTGGTAACTGTGTCGAAGGACTCTGTCGACCTTGGAGTGAAGTTTGAGAACTT
CGATAGCGTGGAACGCTGTTGGGTCTTATACCTGGATGCGAGGTATGACCTCATCGTTGGCATGGCATGGCTGTTACGCCACGAGCCATGGATCGACCGG
AAGGCAAAAACGCTGGGTGCGTCGCACCTGCTCCTAGTGGAGCTTTAGTGAGTGATGAACCCGCCTTTGCTAGGAAGCAGAAGCGCTTTTGACGCGAGCA
CGAGGCCGAGGCGGCCGTAGTGCTGGACATTGGTATGTCAGAAATTGTTAGAAACGAGGTTGCTGTTTGCCCTGAGGGCGTACGTGGTGCGGCACGTTAT
CCGCTGAGCGGTGTCGGTCAAGTCAATGACTAACGGCTGGTTCCTGGTGAGGCCGAACGCGGAGTGGCGCGTAATTCACTGAGTGGTACGAATATTGCTG
ATGAACTACCGCTGCGTGGCCCGAGGGTCGCGATCGATCGCGAGTCGAGGTATCATGGGCGCGGCCCCGGAGATCCAGGTGAAGTGACACCTATTTCACC
GTGGGAGGGTCAAGTTCCTCTTGGCTCTACTGCTGGAACCTGAGGAGGAGTTGAACGTCTCATCCGTCGTGGATGATGCGGTCCTGGAGGACACCAAGAG
GCGCTGAACGCAAGAAGTGG