Description :
From Genome Similarity Track
Location :
Scaffold_3022:976- 2354
Sequence
1378 bases(100 bases per row)
GCCAAGAGAGTGTAGCACACTTTCAGCAATTGCAATAGCGCGACTACTTCTTTCTCAGCGGGGTGATAGCCGAGTTCGTTCTCCTTTAGTACGCGTCCGC
AGAAGCGAACTGGGTGCAGCTTGTCGTCGTGTGGTTGCATCAACGTACTGCTCAGCGCCCACTCATTGGCGTACAACATTATGTGGACTTCTTTCGCCGA
GTCGAAATGACGCAGAATTGGAGCTTCTGCTACCCGTCTTTTGAGCTCGGCGAATGATGCTTTTGCTGACGCCAGGTCACCCCCAGGGCCAAAGTCCGTT
CCATTAGCTACTAGAGTACTGCTCCGTAAACAGCCAAGTTCTGGATGAATCGGCCGTAATAGTTGAGGGCACCGAGGAACGCTTGCATCCCCTTCTTCGA
TTTCGGGAAGGCGAGCTCGGCGATCGCGGCTATCTTCTTCGCATCAGCGCGTATGCCACTCGGCGTAATCTCGTGCGATAGGAAATCAACCTTGGGTTGG
ATAAAGATACTCTTGGTAAAGCTGATGCTAATTCGACATTCTGTGAACCGGGCTAGTAATCGGTCGAGTGTCTCCAAGCAGGCGTCGAACGTCTCCCCTC
CAAAACAGATATCATCGACAAACGACCTCCGCTTGAACACCGGAATCAAGGAAGACTGATCAGGTTCTCCATCAGCAAACATGTCGCCGTCCGGTCCATT
GACCAGGTCTTGGACCGGATCGCAGTCAGCTTGTGATTGGTGGTCAGTTTCAAACTTCGTCAGCTGACTCTGCGTTGAATCGCTGATTCCGTCGAGCTCA
ACTCGCCGAGTTCCCGACTCGGCTTCAGCAACAGCCATTCGTTCGGCAAACAGTTGCCATCCTCCCTTTGGTTGAACGTATCCCCATAGAGCGTTGTCGA
TTAGTCGCTGGTAAATCATAGGCGCATTCTTCAATCCAAATGGCATTCGTAACCATTCAAAGTGTCCAAGTGCACATACGAACGCTGAGATCTGCCAAGC
TCGGCGTGTCATCAAGACTGCCCAGAATCCACTCGCAGCATCGAGCGAGCAAAACCACAAGTAGCTTTCCAATTCGGTAAGCAGGTCATCAACCAGTGGC
ATAGCGTATTCCATCGGTGTCGTAACCGCATTAACCAGTTTATAGTCAATGCATAGTCGAATATCCCTACCATTTTTCTTGAGCACTATCACCACTGGCG
AGGCCCAAGGGCTGCTCGAGAATGATATCAACCCAGCTCGAAGCAGCCCCTTCAACAACTCGTAAAGTTTGCTCAAATGGCAGAGAGGTATCCGCCGAGC
TCTCTGCTTAATGGATGCGTGTCCTTGAACGTCGATGTCGCACAATGCTCCGTACGCTGGAGGCGGCAGGGCATTACC