Description :
From Genome Similarity Track
Location :
Scaffold_31:97595- 105509
Transcript NameFunction/comments
Physo_134313pol protein
Physo_134314hypothetical protein

Sequence
7914 bases(100 bases per row)
CGCCTACGCGGGTAGATTGGACTACCTGAATCCTCTGTGGTCTCATCGAGTGAGCCAAGATGGATCGTACGGAGTTTCCCCATCTGAACGACTCGCAGTA
CGAGTCCGTTCGTAAGATGGCAGGCAACTTTGGGACAGATGCCCTGCGTAGCTTAGCGGCGGCGACGCCGGCTGAGCAGGTTGAGCGTATCAACGCGTTC
GACACCTACGAGCGAGGGCTCATCGCCCACGTTCAAGGGCTGCAGGCCACTGCGGCCGCGCCGAAGCCGGTGCAACCGAAGCCCCTGCGGCTGAAGGTTC
ACCCCTTCGAAGGGAAGGAAGGAGAAAACCTTCACTTCTGGGTTCGAGATGTTGAGCTCGCGATGGACGCGGCTCTCGTCTCGGACGAGCGACTCCGTGT
CGCCTTTGCGCTCTCCAACCCTAGTGGTCGCACTAAGAGTTAGGCGTATACGCGCGAAGCGACGACGCGTGGATGCTTCGCATCATGGTCCCAGCTGTGC
GAGCAGCTGCGGGCCGCGTTTCTTCCGGCGAACTACGAGTACCGCCAGCGTTCGCGCTTCCTCGCCTGCAAACAAGGAAGGCGCGAGCTGCATGAGTACA
TCCAGGAGATGCGAGTGTTCACTGCCTCTTTGGTGGGGAACCCCCTGCCTGAACACATCAAGGTGACCGTGTTCATGGACGGTCTGCGTGTCGGTCCTGC
CTGCACGCAACTGTTCCGTGTGCAAGCAAACACTATGGAGGAGGCGATTCAGATCGCCCTCCAGGAGGAGTACAGCCACAAGCAGGCTCGTACCCCCGCC
ACGGTATGGCAGAGCAACCCTGCCTCTGGCGGTGCGCCTAATGGTAACTCCGGCAATGAAGCGATCAACGGGCCGGTTCCCATGGATCTGGGCATGGCCG
AGCAGAGCGACATTCGCTGCTACGGCTGTGGCAAGCTTGGGCACATGAAACGTGCTTGTCTCGCGGGAGGACTGAAGAAGAAGTTCTCTTCGAAGCCCTT
TGGCTCTAGGGGTCGCTGGCAGAAGCCGCGCCCCAGGAACCAGGGGAACGCCGGACACCAGTAGGGGCGGGGCGCCCTACTGGGGAAACACTAAGTCTTC
ATGAGGGGCGTGCGGGTGGCGCACGCCATGGGGACTTAGCCCCTGAGAGTCTCTGTACTCTCGAAGCGGAGAAGGGCAGCGGTGGGCTGCTTGTGGTGCA
CGCGAGTGTACCGGGATACGATCATCCCTTGAGAATCTTGATCGACTCTGGGGCGTCCAAGAACTTTGCGCGCCGCCAGACTGTCGCCCGCAATCGCGAC
AAGTGCCGATGCGCTACGAGGCAGCAAAGGCAACGGGCTGGTCTCGGTAAGACTGGCCGACGGTACGGTGGTAGAAGTACCTCGGGTCCACATGGACCTC
ACTGTCAAGTTCGAGGACTTCGACAGCACGGAGCCGTTCTTGGTCCTAGACATGGACAAGTACGACTTGATCCTTGGCATGCCGTGGCTGGAGAAACACG
AGCCTTGGATCGACTGGCGCGGCAAGGCCATCGGGGCCAGCCGTCCCCCACGCTCTGAAAGAGCTTTGGTGAGTCATGTTCCCACCTCTGGCAGCAGCTG
GGGCACCCACGAGGGCCGCCAGGGCGCAGCAGCGTCTAATGAGTTCTTGGGGTCCGTCGAGACTGACGACGACTCCGACCGGGCCGGACAAGGCCTGAGA
GTGGAGGTGCCGGACAGCACCTACCAGGTGGGTAACGTAGGTCCACACGCGGGTAACGAAGTACCGCAGGCAGCAAGGGCTGCTGGAGAAGGCGCCGCTG
GCGTTGGCGTGGGTAACCAAGTTCCACGCGAGGTCACTCAGACCGTAACTGATGAGGAAGGCACTGCAGGCGCTTCCGATGTGGGTAACATAGTTCCACA
GGAGGTCACTCAGACCATAACTGATGCGGGAGTCGCTGGAAGCGCTCCTGGTGTGGGTAACATAGTTCCACCCAGCAAGGCGGGTAACCAAGTTCCGCTC
AAGAACAAGGCGGGTAACCAAGTTCCGCTCAAGGACAAGGCGGGTAACGTAGTTCCGCACGAGATCGAGAAGATCGGTGGTGCCGTCAAGGCGGCGCCAC
GAGACGAAGACACCCGAGGGTCACGTCGTAAGCCGGGCCTAGTCGTGTGGCCGATGACGCCAGTCGCCAGCGACTCCGAGCCTCCAGCCAAGGCTCCAGC
CGCCGAAGAGTGTTATCACATCTTCGACGGCGTGACCGGTAGTCGGGTCAAGACAGGAGCTGTCGAGCTTACAGCTCTGCCCGAGGTTTCAGAGTTGCTG
AACCTTGGGGAGCTCGCCATGGAGGACTTCTTGGCCGAGCTAATGGCGGGGGAGATCGCAGAGTTGGTTCTCCTCCGACCGGAGTCCACGTCGGCCGAGT
TGAACTCGTCCTCGGTCATGGACCAGGCAGTCCTGGAGGAGTTCCAGAGACAGCGCGCGTCGCGCATGGGCTCTGAGATTCTTAAGAACCCCCGGGACCC
GGTGTACCCCTTGGTGAAGGAGTTTGAGGACGTGGTGTCCAAGGATCCACCGTCCAATCTCCCTCCGGACAGGGGAATCAGGCACGAGATCGATATCGTG
CCGGGCACGAAGTACTACGTCACGAGGCAATGGCCTCTTCCCCGGGAGCAGTGTGAAGTCATTGATGCCTTCTTTGCCGCCAAGGCGGAGGCAGGCATGG
TGCGGGAGTCGAAGTCCCCGCACTCGACGCCTACCTTCTGTGTTCGCAAACCGAACGGAAAGTGGCGTCTGGTTCATGCTTATAACAAGCTGAACAGCGC
GACAGTGCCTGCGCAGACACCGATCCCGCGCAAGGACGTGTTGCTCAACAACATGGCCGGCTGCATGCTGTATAGCGCGCTGGACCTGGTGGACGGATAC
TACCAGATCTTGATGCGCGAGAGTGACATCCCACTCACGGCTGTGAGCACGCCGAGCGGTATGCTCTGGGAGTGGCTGGTCATGCCACAGGGGCTTTCTA
ACGCCCAGGCAACGTTCAATCGCTTAGTCACACAACTGTTCCGACCTTTGCGTGCGTTCACACAGACGTACTTTGACGACATCTTCGTCCACAGCCGTGC
CGAGGCATGCCAGACGGCCATGGAGGTGCATCTCCAGCACCTTCGACGTGTGTTCGAAGTCATGCGGGCGAACAAGCTGTACGCCAACATCGACAAGTGT
GTGTTCGCAGCTGAGGAGATCAAGGTCCTGGGCTGCTTCGTCAGCAGCGCCGGGGTCCGGGCGGACCCAGAGAAGGTGAAAACCATCGCGGCTTGGCCGC
CACCTCGGTCGCAGAAGGACCTACGACAGTGGTTGGGCCTCGCCAACTACCTGCACAAGTATAGTGCAGGCTACGCCGAGCTGGCACGGCCCTTGTCGGA
TCTCCTGAAGAAGGATGTCGACTGGCGCTAGGAGCGTCGCCATCAAGATGCTTTTAACGACATCAAAGCGAGCTTACAGCGCGCGCCAGTCCTGGCATTG
CCGGACGAGACGAAGCCTTTCAGCGTAGTCTGTGATGCGTCTGACTACGCAATTGGCTATGCGCTATTGCAGGCCGACGATGAAGGCCGCGAACGGGTCA
TCTCGTTCCAGTCCAGGCAGCTCAAGGCAGCCGAACGGAACTATCCAGTCCACGAAAGGGAGCTACTTGCCATGAAGTACGCTCTTGTCAAGTTCCGAGT
GCACCTCCTGGGCTCGACGCCCTTTGTCGTTTATACAGACCACGCGTCCTTGCGGACTGCCGTCAACACGCCGCATCTCTCACAGCGGATGGCGCGTTGG
CTGTCATTCTTCGTGGAATACAACTTCCGTGTCGAGTACAAGCCGGGCAAGTTGAACGTGCTTGCCGACGCGCTGTCGCGCCGACCCGACTACGAGCTTG
CTCATATTAGTCGGGTCACGACGGATCTGTATGGGGTACCGAGACGATGCCAGTCTCGAACCTCTTGTGCGGTTCTTGGCCGCTGGCTTGGAAGCCAAGG
CCGAGTGGCTCACGCCCCGACAACGTGCAAGGCTGCACCGCTATGAGTGGGCTGACGGTTTGCTCCAATATAGGGTCGAGCCCGAGGATCCTCCCCGTAT
TGTCGTGCCCAACGGCGAGGATCTCAAGTACGTCATCCTGATGGAGGCGCACGACGCTCCATCCAGTGGCCATCTCGGCCGTGAGAAGACGTACGCGTCT
GTCTCGCAGATGTTTTGGTGGCGTCACATGTACAAGTGGGTCGCCACCTACGTCCGTACGTGCGAGACGTGCCAGCGCGTGAAGCCTGCCGGTCACGCCT
CGGCACCATTGCAGAGCCTGCCGGTCCCAGCGGACTGCTGGAAGTCGATGAGTCTCGACTTTGTCTTCGGACTTCCGGCCGATGACCGTGGCAACACTGG
TGTTGTTGCCTTCGTGTGCCGTCTGAGCAAGGTGGTCCACTTTGCTCCAGTTCGTGATACCGTCACTGGCGACGAGGTCGCTCGCCTGTTCATGGACTGT
GTCTTCCGACACCACGGTCTGCCCGAGACCATTGTCTCTGATCGAGACCCGCGGTTCACCGCTACGTTCTGGCAGACGCTGTTTCGCCTTCTCGGCACAC
GACTGTCGATGTCGACGGCGGACCACCCGCAGACGGGTGGCCAGACGGAGCGCGTCAATCGCGTGCTCGAACACACGCTCCGCAGTATCTGCGCGGAGAT
GCCCCGCTCTTGGGCTGATCGCTTGCCCATGGTTGAGTTCGCACTCAACAATGCGGTACATGCATCGACGGGCTTTACGCCCTTTTACCTGAACGGGTTG
CGCCACCCTCAGGTGCCGCTCCCATTACGAGGCAGTACCGGGGCTTCGGTCCTAAGTGGGGGAGAGGCTCGGAAAACCTTTTCCTCCCAAGTCTCGGACG
TGAGTCCAGCCACCTTGCGGAAACAACTGTCCTCGTTTGCCGAAGACAGGCTGAACATAATCAGCAGGGTGCGAGACACCATGGCGCAAGCCCAAGATAA
ACAGAAGGAGTACTCTGACCGAAATGGAAGAGGAAACATGAACGTGTTTAAGGTTGGGGATTTAGTTCTCCTAGATACTAGAAACCTACCGCTAAACACT
GTTAGCTCGGTCGAGAGCAACAAGCTGAAGCACCGCTTCATTGGACCCTTCACGGTCCTCAGCCGACATGGCGCGGCGTACACCATAGACTTGCCCAAGT
CGATGACGACTCACCCGACGTTTTACGTGGGTCGTCTTAAGAGGTACCATGACCCTCTGGCTCTGGCTGCCCCGCAGGAAGCGGTGGGTGGCCCGGTGGA
GAAGAGCGCAGCTCCTCGAAGCGCGGCGTCGAGTCGCGGTAAGGCGCCTGATATCGTAAGACGGCGCGGCGTACATCGGAGTAGCATACGCAGGGGCCCC
GTACGAGCCCTGGCCAAACTGGGCCTGATACGAGTGGGGCTGCTGCTGCTCCGGATACGGCGCGTGGCCATGAAGCTCTGCCCGAAGGCCAGCGAGCTGG
TTTCGCAGCGAGTCGAAAGACGACAGGTCGGCTCGACGATCCACACGGCCATGGAGACTGCGAGTTTCTTGATAGAGCGAGGCAAAATCCTCACGGCACC
AGGCTGACCAGCACGAGCGGCAGCCTCGCCACCAAGGCCGACGCCAAGCGCGATCTCGAGGACGTACACACGGTCCCGGAGAAGACGAATCTCCTCTTGC
TGCAGGGCCACCACCTGACTCGGGGCCCAGCATACGGCTGCGTCGCCTCAGGCTCGTAGCCATGGCCGTGCGAGGCCACCGCCGGCCCTCCTTGATCGTA
ATGGGCAAATCCACTACCACGTGGAACGAGTCGTCCGGGAGCGGCGGCTCCATGGCAAGCGCCAGCTGCTCGTGATGTGGATGGGTTACCCTGAGTCGGA
TACCTCGTGGGAGCCCGTTGAGCAGCTCCAGGCAGACTGCCCGAAGGCTGTTGCGATATGGGACGAGAAGCAGCTGCAGCTTCGTAAGTAGTCCTTGGCT
TCTTGGCCGATACCCGGGGCACGGTAGCAGACGTAGTCGCACCACGCCCACGCTCTTCACGAGCTTTGGCTCTCGCCTCTTGCTTCAGCTCGTCCATTTT
CGATTGGAGCTTGCGCTTGCTCATGAGTTGGGCGAACTCGATGCGGAGCTCGCGCACGTCCAGGATTGCGGACAGAGTGGGATCCTCACGGAGTTCTTTG
AACTCTTGGTCGGAATACCCTTTGCGCTGGACGTAGCGCCAGAAGAGGTCTTCCACCTCGCTCCAGGTCATGTTGTCATTCGGCTTGACCCAGTGGAAAC
CCCACACAGGATGGAGTCCACCCTTGTCCTCCGGCTTCTTGCGAAGCGTGGTGAACGCCTTCAGTGTGAGCTTGTGTGGTGCTAGTAGCACACACCGGGC
GACTTCAACGTCGCCAAGAAAGAGTGGCTCTTTCTCAACAAGAGCACGCTCATAGGAACCCCTCGAGGTGTACCCGCCGATAAGGCCACGAGGAGCCGAG
AGCTTCTCCAACAGCGCTGGCGCACCAGTGCCAGGATCGGGCGGGAAGTAGCCCTGCGGGTACGTGGCATCCCCGCCTGAAGAAGACTCGATGGCAGTCG
TGGCAGTCGGCTGCCTGGCATACACACCCGAGCTAGCAGGGTGGTATTGCTGCTGCTGCTCGTCGAGGTTGTTGGAGAGCTCCTTGGGCTCGTGGACGGC
ACCCTCCTCGTCCTCAGACTCCGAGTCGATGAACAGCTTGGAGCTGGAGCCGCGAGGCGACCTGGAAGCTGAACGCTTCTTCGCCTTGGCCTCGGCGGCC
TTCGCAGCGGCAGCCGCTTTCGACGCTTGGGCACGCTCACGACCTTGTGCCAGCGTCAGATGCTTGGATGCCAGCACCTCCTTGGGCTTGGAGCCCGCGT
CGCTCGGCGACTTCTCGGCCACGACCCCAGCGTCGGCCATGGCGACTTCGTCGTGCGACTGCTTGCTGTCGCCTGAGCCAGACTCGGCGTCCTCCGCCTC
CTTCTCTGACGAGGCCTTTGCGTCGGCCGAGGCGTTGGTTATGTCGCCTGCCGCCAGCTCCGTGCCTTCGGCAGCGTGCGTGATACCCTTCGAGACGTTC
TCGTCGTCGGGTGAACTCTCACCGGAGTACTGGACCATCGTGCAGTCAAAGACGGCGGCTTCCCAGTCGCGAGCCGGGCTTTTATGGCCCCGAGGACTCT
CCTCCTTGCCTTGCGCGGCGTCAGGAGACTTGCTCCGAGCCCCGGCCTGACGGCCACTCTCCGGCGTGCTGCTACGAGAGCGCACCACCTCCTCGGCCGC
CTTCGTGGCCTCCATCAGCGCGGACGACTCGTCCTTGGCCTTGGCCGCCCTGGTCTTCGGCCCTACGGCCCGCGTTTCGGAGGTGCTTTCGCACTGCGCG
CACTGCGCTTTGGAGGCATGCTTCCGGTCGACGTGAAGACCCTGCGGCTTGCTCGGCGATGCGCCAGTTGCTCTGTGAGGCCCGGGAGCCAAGGCGCCAG
AGCTCGCGTCGTTGTCGATGGATTTCGACTTTGCGAGTGAAATGTGAGTCGCCGACGTAACCTCGCTCTGATTGGTCAATAAGATCGAATCTAAGTGGGG
GAGGATGTAACGGGGTTACATGGAATAGTGACCCTGTCACTATTCCGGGATGGCTACATCGGTCACTCCCCTGGATAGTGACCCAAGTGGCCTCAGAGCC
AACATATACACTTTGTATTACACAAACTATAGGGAACTTAGGATTTGTATGCAGGCCAAATCTGTACCAACCTATAAATACATTCAGTCTTAGATCTACC
ACTTTTCAAGTCAAGTCGTCCCGTTCAGACCAGGGACACGTGAACGGCTGTTCACTTGGAGTTTGTATACTCCTGCTTCCTCTGATAAGAAGTGCTGTGT
GCCCCGTCACATGT