Description :
From Genome Similarity Track
Location :
contig_5:97586- 103345
Transcript NameFunction/comments
g1308.t1serine hydrolase (FSH1)-like protein, putative
g1309.t1elicitin-like protein RAL7B
g1310.t1hypothetical protein PHYSODRAFT_388694, partial
g1311.t1Sodium/glucose cotransporter

Sequence
5759 bases(100 bases per row)
ATACTGAACGGCACGTACGAAGCCCGCGGGACAAGTGATCCGATGATCGAGAGTGCCTACGCGTCCAGTGCTCCATTCTACGAATGGTTTGAGAATCAAC
TCGCCGACGGATCCCCGCTGCTCTACAACGACGCTGAGTCGTCTGCCAAGGCGCGTCTGCAAAGTGGGGCTGACCAAGGAGCAGACCACGCGTGGAGTCT
TTCCTACAAGGGCGTTGAGCAGTCAATGATGAGAATTGACGAGGAACTTCGTCGTCACGGTCCGTTTGACGTCGTCATCGGATTCTCCCAGGGTGCTGCG
CTGTTGACGATTTTGACTATGTGGTACTTGCACCATGGCAACGTGCGCTGGTGGAAGCTCGTGATCTGCGTCGGCGGAGTGGATGTGAGTGGCGTCAATG
TGAGGTCGCTGTTCCTGGACAAGCTGGGCAACCGCATGTCTGTGCCGATGCCTTCCATTCACCTAATTGGCAAGACAGACCCGCTTTACCACGAGTCGCA
CCGACTGGCGTTGTCGTGGGCGGACAAAGCGGATCCCAATGACTTTAACAAGTGGATTTACGAGCATGACGGCGGTCACAAGTTTCCGTCGGTATCGAGG
AACCGTGAGTTCTATGCGGAGTTGGGGTGTGCCATCAAGCAGCACTGTGGCAAGGGGGCCAAGACAGCTTCGGCCAGACTTTGAGCTCATTATGATATGG
GGTAGCACTGAACGTGTAGGCTTGCGCTGTACACTGATACGAAAGTACACGAAATGTGTGACGTTTAATACAACTGAGTCTTGCCATCGCATAAGGGAAG
AGGAATGGCGACCGAAGAGAGCGTATACAAAGAAAGCAACCAAGGTAGACCGTGCCAGAACGAACTGTGAGGCAGGTCGGACAATGCAAAATACTCAAAA
TCACATCAAAATGGACCTGCATTCATGAGCTCGATTACTACGAGCTGATTGCCACGACATTATCGTTCCTCGTAGTCGTTGCGTAGCAAGCCAATCGCTT
AAGCCGAGAGGTTGAGAGCTGTGCAGTTGGGCTGGAAACTCTCCGCCAGCTCCAGGACGTTGATCGAGACCGTTCCGAAGTTAATCACGCAGTCCGCCGG
ACCGAGGGCCAGGAGGTCAGCAATGAGTGAGTAGCAGTCCGCCGTCAGGCACATGAGCAGCACCTGGGCATCGGTGGGGTATGCCGTGGGCGGCACGAAC
GAGTAGCCTGACGCGGTCTGGCATGAGTCAAGGTATGGGTCCGCGGCGAGCTCCAGAAGCTTGGCAATCTCCGACGAGGGGCACACAGTAGTTTCGTCGT
AGGCGATGGTCTGCGTGGCAAAGCAAGTGACAGCGGCGGTGGCGGCGTAGGCGTAGGCGAAGGTCTTCATGGTCTTGGAAGGGGTGGAGGATGGCGAAGC
TGGTGTTGGAGCTTGGAGGAAGATTGGATAATGAGCTCCTGCCAGAGCCTCGAAACGGAGGTTGGTGCTCTAAGGCAGCATCGAAGGTGGGGGCCTCATC
TACCAGCTAAGTTGCATGGCGATAACGATGGCAAGCACTAGGGACACGTGCTGCGGCGGGCGCCGCTTCAACAAGGATGGTGTTCAGGAGAGGCGACTCA
CACGAAAGTGCGGCGTGGTTTTCCAACCAAGTCTCTTGACAACTGTGGCACAGCGTAAAGCTCGGGGCGAGCTTGCTGATCATGCAGATGCGGGCAGCTT
CAACTTGAGACCGTCCGTAACTGAGACCTTGCTTCCGCCGTTGCAGGCAGTGCTGACTCAAATTGGCTTGCAAGCTAACTTACGTTCGAGATGAGCAAGC
GATCTCAATATGATTGCCGCAGTACGACCCCAGGCCATCTATCCTACCCAATTCACAGCCAAATCCTCGCCGACATCCCCGTGACCTGCAGCATTTCCGG
CGCTATCTTTGAGTCAGCGGAGCCCCCCCCCCCCACCCGACTGATCGTCCCGCCTCAAGTCCACACTGCCGTGATCAATCCGCAAGTACCCCGGCAAGGA
TATGTGTCGACTCGACCTTGACACTGTCGACCGCAACTGGAAGCAGCATTGTTCGTTTTCACGTCGACACCATCCGTGCTGGTGTTCGACTGTCGTGCGG
GAAAAGCTGTTCGCGTTGAAGTGCAAGGAAGCTGTTGAAGTTGGATTGTGTAGAGTTTGTGTATCAGAATACTCCACCTAATTGCGAATAACAAAAATCT
AATTGCTCTGCTGAGTATGCGTCACTTGCTGCTGTTCATGGGCCTGCCTTGCTCGACTGCACTTCACGTTGCCCCCTCCGTCATTGAAGTGCATAAAGTT
CAACAGCCACTACCTCCTCCAACAATTTCTGGTCCTCCTGCGTCGACGTCTCAGTCTCCATGCGACTTCGCACACCTACACCCTCGACGATATGCCGCTT
ACCACCTTCCACCGCCAACGGACCAGTTCCCAGCGAGCATCACCATCGACGGAGTTTTGGGCGATAAAGTGTGGGCCGAGGTGCCTTGGAGCGAGTCTTT
CCAGGACATTCGAGGCCCAACGTTCTGGTCGCAGCCGTGGTTCACGACCAAGTTCAAGCTCCGTTACGACCAGCAGTTTCTCTACATTGGCGCCTACTTG
GAGGAGACCGAGGTGTGGGCCAATGTGTCAAAGCGCAACGATGTGGTTTTCCACGACAACGACTTCGAAGTGTTCGTGGATGCGGACGGGAGCACGCACA
ACTACAAAGAGTTCGAGCTAAACGCCCGAAACACGACCTGGAACCTCTGGCTCAACCGTCCGTACAGGGATGGCGGCCACGAGAACAGCACGCGAGTGGA
TCCACAACACGGGTTCGACATGCTGGACAGTGGCATGCAGGCTGCAGTGTTCGTCAAAGGCCGCATCAACGACCCATGTGCGTAGTGTGCAGTTTGAGAC
GCTCATGTCTGACATCGGGTAGCTCATGATCATGTTGATGTCACATTCTAGCCGAGCGTCTGCACTACTGGACTGTTGAAATTGCGTTGCCATTGGCACA
ACTTGCACTGCATTCGAAGGCACCAGTCCCCCCGTCGAAAACTCATTCTGGCGCATCAACTTTTCTCGTGTCGAGTGGTCTGTTCGCGTCGTCACTGACG
GCCTCACGGGGGGACAGCACTACGAAAAGAAGCCCGGCTTGAGTGAAGAAAACTGGGTGTGGAGCTCACAATACGCAGTGGATATGCACCGCCCAGAGTG
GTGGGGGTATCTTCAGTTCCGCCCGCAAGGCGAAAGTCCACCTGCGTTTGCTGAAGCGGTTGTGCCGCCTGATCCTGAGTGGGGTGTTCGGTATGTAAGC
TTTCAGTATTACTACGCGCAGCAAGCCTTTCATAACGCAACGGGGAGGTACACTCCTAGTCTGGAGCAACTACTTCCGTACTTCACTTCTCGTGAGGCCA
TTCAGTGCACCAAGCTACTCGATGTCAGTACCACAAGTGAGTCGTTCAGTGCACAAATCGGGTTGAGAGAACACGCACTCGGCTCCGACGTTACCTCGGC
ATTGGTTGCAAGCATCGAAAACGATGGATATATTTCGGTGGAGAACATGAGCTACACATCAGCCATTGCTGTGGCCGAGTAAGGCCAACCAACACCTGCA
AGACGATAGAAGACTTAACTGAAAATGACTGATATTTGAGTTTTTTACATGGCAGCTTCGCTGAAGCAACCCCACATACGTACAATCTCTCTCGCTTCTC
GTCTTCGTTACGCAAAATGCTTACGCGAAGTAGATCCACATGCTGAATGTGACGGCCAGAGCAGCGATGGCACTTCCAGCAACGAGAGCGTTGACCCACA
TAGGTTTGGTGAGCTCCGTGGCATCGAGCTTCAGGACCTTGTCCCAATGAATCATATACTTGCGGATTTCATCCGAGGGACGGCTCTTGTTCTGAGTCAA
CAGACTCACCACGACGCATACGACCCCGGCAGTGACCCAGCAGCGCAAAGTGCTGGAAGTTCATGTAGAAGAACGTATTCCAGATTCCAGGTAGGTCGCC
GTCCATGCTGTCGTCCTTGATCGTCACGAAGATAAGGCGCGAAAAACCGAGCAGACCGCCCACGATCATAGCCGAGAACGCTCCGTACACGTTTGCCGGC
TTCCATGCAACGCCAAGCACGAGCACAATACCGATAGGAGGCGTCAGGTAGCTCTGGATTTCAACGATCTGCTAGAGACCCGTTCCGTTGCGCATGATGG
GATCCAGCAGAAACTCAGGACGGCAAAGATGAGGATGCTCATGCGACCGACCCACACGAGCTGCTTGTGCGAAGCGTCCGGGCGGAACTTGAGGTAGATG
TCGTTGGTGACGACCGACGAACCAGCAGCAAACACGGACGCCAAGCTCGACATCATAGCCGTGATGATACTGGAGATCATGAGGCCAATAATGCCATGAG
GCATCATTTCGGTGAGCAGGGTCGGGTACGCAGCGTCGGTGCCGTCCTCAATCTTGCTGAAGTCGAAGTAAATGCTGGCAATGATACCCGGGATAACAAT
GAGGAACGGAGGGAGCACCTTGAGCATACTGGCGAACGAGCAACCAGCCTTAGCGTTGGCCGTGTCCTTCGCCGACAACACACGCTGCACAAGATCCTGA
TCCATGCACCAGTACCAGATCGAGCCTAAAGGCTGGCCGAAGATCATACCCGTCCACGGGTAGTCGGGGTCGTCCGTGGGCTTCCAGAGGTGAAACCACC
CTGAGCGGTCCTGGTTGTCCAGGTTCTCGCGGATGCCCTCAAAGCCACCGATTTGGTTCACCGAGTACGCGAACACAACGAGGCCACCCAAAGTAAAGAC
ACACATCTGGAACAGATCCGTGTACATCACTGCTCGAAGACCACCGGCAATGCTGTACATGGCACTGAGGGTAATGCAGACACCGGCACCGAGATACAGG
TTCCAGCCCAACGTGGCCTGGAAAACGATAGCACCACCATAGATACTGGCACTCATTTTCGTCAACACGTACATGATGATCGTGATGAGCGACAAGTAGT
GACGGCACGGAGCACCAAAGCGGTACTCGAGATATTCCGGCGTCGTATACACACCGCAGCGGCGGTAAATGGGGGAGAAGATCCAGCCCAAGCACAGGAT
CAAAATGGCAGCGTACCACTCGTACATGGCGACAGCAATGCCGCGGCGAGCACCATCACCGGCCATACCAATGAAGTGCTCGGCGCCAATGTTACTGGCG
AACAACGCACCACCGACGAAGTACCATTGCATGCCGCGGTCGGCCAGGAAAAAGTTGGACACCTCGTTCATTTGGTGCTCTGGCCCGTCACGAGCAATGA
GAGAGGCCGACGGACGCTGAGATGAGATTGCTGAGCCACGTTCGTCTCCGGGGGAGCTTCTTGCCCGGGGTGGGCTCCGAAGCCAGGTAGCCGTCGCCGG
GTGACTCGAGCACTTGGTCGTTGTTGCGTTTGGATCGTTTAATACAGGGAAAATACTTGGCCAAGTGACTCTCGCCTGCTTGGATGGAGGCGATGACGGC
CACGACCATCGTGAAGAACAGCACCGTCACAATGATGACGACGTCCCAAGCGTTAACTTTGGCGCCCCCGGAAGTGTCGGGCACCGTCTGCGTGTACAGC
TCGACCATGGCAAGGACTTGAACTCGACGAAGGTAGACTTGACTTGATACAGGGACCAAGAACGGAGGAGAGTCGCTCGCTCTCCAGGCGGTGAATTGGA
TAATGAACTGAACTCGGGACGGTGGCGACAACAACGGTGGTGTCCATGGATGGCACCAC