Description :
From Genome Similarity Track
Location :
Scaffold_43:97566- 99046
Transcript NameFunction/comments
Phyin_T30-4PITG_16162Amino Acid/Auxin Permease (AAAP) Family

Sequence
1480 bases(100 bases per row)
CTCTCTTCACGCTTGAGGATGCGAAGATCGCTTTCAACATTTTTTGCTGTATCTGCGGAATCGGCTCACTCGGCATGCCGTCCAACTACGCTCGCGCCGG
CTGGGGTTACGCGACCGTCGCGTTATTATTCATGGCGGTATCGAACATCTACGCCACCGTGCTGCTGTCAAAGGTGCTGATGGTAGCCCCATCTTCTGTG
AAGACTTACGGTGACCTCGGCGAGTGGGTCGCCGGCAAGTGGGGCCGTTTTTTTGTGGTAGTCTCCCACATGGGCGTTTGCCTTCTTGCTCCCTGCGCAT
TCCTCGTACTTGGTGGTACGCTGTCGACGTGCTCTGTCCCGATTCGGTCAGACAAACCGTGTGGGATCATCTTCATGGCTGCAATGGTCATCACTGTGGC
GTTGATCCCCACTCTGAAAGAGAGTGCCTGCATAGGTTGTGGAGGGGATGCCTGTGACATTATCATCGCTGATTATCATCGGGAGTTGCGAAATCTCTTG
TAACGAAAAAGCGCGCCACATACAATCCCGCCCAACTCCCAGCAGGTACTCTTCAACAGGGGCTGCACCACGATTCGTAACCCTGTCTCTCGCGTACGCC
GCTGCTATTGTGATCCCCGACCTCCAGCGACAGCATTCACAGCCCGAGCGCATGCCTCGTGTCATTGTCGTCAGCCTGGGTCTTGCCTCGGCCTTCTTTC
TCGCCATCGCTATTATCGGCTACGTTGCTGGTGGGTGCCAGCTCTCCGGTAATCTGCTCTTTTCGATCGTGAACACGTCCGACCCCTACAGCACCACCAC
TCTGGGTTTTACGGCGAACCGGGGAGCAGTGGTCATGTCCTACTTATTCATGCAGCTTCATCTGTCGATCGCCTTCTCGACAATTCTACACCCGGCGTTT
TACATGGCGGAGCGTCTCGTGTTGGGGATGCACAAGGATGACACGCTTCCTACTGACAGCGAGGAGCGTGAGATTGAGATTGAGGAGAAGATGTCGTACC
TCGGTGCGGCGACCCCTGCATCTGCCGTCCCCGATCTCGAGAACAACACGCTTGGTGCTCAGAACCAGTGCTCGGTGCGTGAGTCGAGGACGAAAACTGA
AGATGACCTCTCTGAGTACAAGGGCAGCGTGAATGTGGTTCGTTACGTCCTGGTGCGTATCGCTTTGATAGCGATTCTAGCTGTGGCCTCTATCCTGCTG
AAGGACCATTTCCTCGACTTGGTGGACTTTACTGGTGCCACTGCCATCACTGTGTGCAGTTTGATCCTGCCGCTTATTTTCTACGCTAAGGTGTTTTGGA
GGAAGATTCCGATGGGGGAGAAGGCAATTTGCATCACGATCTCCACAATCTGTGGAATCGTCGGTTGCTATGTGATGATCTACGCAGGAAAAAAACTATT
CAATCCGGATGACGATGGAGCCACGTTCCCGTACTGTTCAACTGAGTACCAGGACGAACCGTACTATATAAGGAATAGTA