Description :
From Genome Similarity Track
Location :
Scaffold_3:975587- 976610
Transcript NameFunction/comments
Physo_253303Avr4-associated TDF-like protein

Sequence
1023 bases(100 bases per row)
GAACTAGGTGCACGCCAAAGAATCCGGGCGTCGCCTCGCCCTGCACCTCACCGAAGTACAGCTAGAACGTCTGCTTCCACGCCTCGACCGCCTCGCGGTC
GGCCATGAACTTGGGGAACTCGTCCACGTTGGCAATGTCGATCTCCCACGGGTGGCTCGAGCCGCTGTTGGGCGCCAGGTCCACGCGCACGTTCTCGGTG
ACGACCGTCTTCTGCACCTCCTCGGAGATGGCCCAGTTCATGAAGAGCTTGTCGGCGGTCGGGTGCCTGGCCTTCTTGAGGATGGCGATCCGCTGGCCCC
ACGACAGATAGTCGTTGTCACCGTCCGCCCCGAACGTCACGTTGGGCGTACGTGCCGATGCTGACCACCTTGTCCTTGGCCGTCACCGCGTCGCTGGCGA
TGGAGCCGCGGCGGAACATGACGTCCTGGTTCTTGACCCAGTCCCAGCCGTACTTCTGCACGTAGCACACGTACATGAACATCTTGCCGGCCCACCGCGG
GTCGACGTGGTCGGCCACCGACTTGGGCGCGGGTTGTCCGCCCAGCGCGGTCTCGTCGTACAGGTAGCTGAAGGTGATGCTCATGTAGGCCATGTAGGCG
CCGCGGTGGTCGCAGTAGCCGTCGTAGACCTGCGAGAAGTTGGCACGCTTGTACTCGAGCAGCTTGCCCTCCCGAGCCCAGCGAGGGAAGTCCTGCAGTG
TCTGCAGCACCACGAGGTCAGGAACGAGCGAGTCGGTCTCGAGCTGGTTGTCGATGCGCACGTCGTGGTACTTGCTGTAGTCGATGATGAGCGTGAAGTT
GATGTCGGGGAAGCGCTAGGTGAAGGCCTGGCGCACCCTGTCCTGCTGCAGCGCGAAGTCTCCTCCGTGGTACATGACGAGGTTGCCTCCTTCGGCGATG
GCGTCGGCGTAGAGTGCGTCGAGGGACTTGGTCTCTTCCGGGACGGCCGGCAACGACCGTGGTGGACACAAGGAGTGCGCAGCAGGCAGCGGTGAGGGGC
GCGAAAAACTTCATGGCGACGGG