Description :
From Genome Similarity Track
Location :
Scaffold_630:9755- 18871
Transcript NameFunction/comments
Phypl_g9931hypothetical protein

Sequence
9116 bases(100 bases per row)
ATTCTACTCGGCGCCAGGACGAAGCGCCTTCGTGggtcgaactgctgcagaggCTGAGCCCTTGAGTACAGCGTATTTGCGCTTGCGCATCTGCTTGGTA
TGACGCTTCTGCTCGTTCTTCTGCATCCTCCGCTGGGCCGCGCGCTGTGGGTCTGACACAGCTTCAGtgcgacgctgcagcttgcgcgcGGCACGACGtg
ccgccatcttcttctgaACGAACGAGTACGCCTCCAAGAATGGCGTGGCTCCCAATTtctgctcgagaagctgcagcacctcctggGCCAGTAGCGCGCT
CTCTGGCAGCGTCACGGGCTCCGGAGTGGGGCCGCCTCTGTAATTCTTGTTGCGGTTacgctgccgttgctgcagcatcacTTGCTCCTGTCgagcctgc
agctcctcaagCTTACTCGTGGAGCGATACAGCGGGTTAATGATCTGCACGACGTACTTTTCAGCAAAGGCAGCGTCGCGACTGTGTAGCAGAGCAGCGA
ACAGCTTGAACACCACAGCCTGCACCTCGTtactgcagctcgagccacGAGCAACATACGAGAGACGGGTGAGTAGCCAGCCCATGGGCATACGAGACTT
GGCACGCTcttcgtccttctccttctgctcgcgacgctgcagttcctcttcgtcttccttctcgtcggccttctccttgtcgccatcgtcttccttctcg
tcggTCTTCTCCTTTCCACCATCGTCTTCCCCATCGttttcagcttcaacagTAGCATCAGCAtcagcctcgtcgtccaccatTGCCTCGGCGGCCGCAG
CAGTAACATCCTGCGGGGCATCCGTGGTCTCAAGCGCTTCGCACAAGAacggcagcgccgtgagcACCTCGTTAGCAAGACCATCGTTCAGAGCCGGGGC
TTCGAGCAACTTGCAGAACGCACTAGCCCAAGTGAACAGACGACCGGGACGCTGCAGGTACAGTGCACCGTTgcggaggcgctcgagggcATCACCAGAC
ACACGCTTCACTGGAGCAGCGTAGGCAAGTGTGCTTgcctggcgacgacgcagatACGACGTCAGCAAACGGGTCGCGCCGAGACGCACCCACGCGTGCG
ggtactgcagcagcggcagcaccacgacaTCCAGGAAGTTCTTGGTCGGCTTCGACTCCTCCAGCCACAGCTCGTACGGGCCAGGAAGATGGTCGCTAAA
GGCGGTGAGTGCCACGCAGACGTGGTACGTCGGCTGCCACCGCACCTGGTTGctgtcctccaccgtctgAAGCTCGCGCTGACGACGCTCCAGCGCTGAG
CGAGCCGCGAGGAGCACCTGGGGTGCACTGCGCTCGAAAAACTCGGGTCGGGTCTCCAGCACAAGCGTTGTCACCTGCGCCGAAGTTCCCAGCAGCTTTA
CCGCATCCGCAGCATCCGAGTTCGAAGCTTGCGTCCACCACGTGCCCACCAGCAGAATGCTCTCGTTCAGCTCCTTGTTGCCCATACGGCGCACCAGAGT
GCTCAGAGCACCGCGAGCCAGGTCACGACACTCCGAAGCCTCGTCGTTGGCCAGACGCAGCACAAGCGgcaagaaaaaaaactggGAGCGCGCGTTGACC
AGGTCCTGCGGAAGCTTCAAGAGTAGCGAACGCAGAGCCTCCAGTACGGCAGAGCGCCCCGTGGCATGTCCGTAGCTCAAGTTGTCAACCAAGAACTTGA
GGTGACGAGACAGGCGTTTGGTTCCAAGAGGATATTCCAGCAGGAACGTCTGGTAAATCGTCGCACAGTTCAGACGCGCGCCAGGGGCATCACTCTGCAC
AAGCAGCTCACCAACACGCAGCATCACATCGTACACCTCACTCACAACGAGACGTGAGTTCACAATGGCCTTCAGTAGAGCGAAGGTGGCATTCTGATGG
TCTTGCTCATCGAGGTCAGCACGCAAAAAGCTCAGAAGAACACGCAGTTGTGGCTCCGTAAGTCGCAGGTTCTCGCTCTTTGAGTCCTTGGCAGCATGAC
CGTTCTCCTGAGCAAGCTCCAATCCCTGCTGTTGTCTGAGGAGGGCGGTAAGCGTGCGGTAGCAGGTCTGCACCATCTCGTTGCGAGTAGCAGCTCCGGC
CTGTTGTAGAATCTTGAAAAGACGGTCAAGAAGGGGCGTACGCGCCACACGCAGAGCGGGGAGCTCTTTCTGGCGGGGAAGCAGCGAGCCTAAGCACTTG
AGCGCGTTAATCACAGCGCGGTCGTTCTTCGACTCACCAGCACAGCGCATtagcagcggcaccagcggATCAACAAGTTGAGCCGGGGCGTTGgagttct
tcttgccctcaTCCTCCTGATCCTTTGCACTACCGTTCTTGCGCAGGAAAGAGAAAACCAAAAAGACTGCAAAGTTCAGAAGCTCGCGGAGGTGTACCGT
GCTCTCGGCCAGGAGAGCGGCAATTTCCTCacgcttctgcttcttggtcttgccTTGATGTTGTTGACGCATCTTGTCGAACCCAgtgacttgctgctgc
atcgtgaTGCGCACGGTCTCCCGGGAGCTCACTCGCTTGGCAAGCAGTTTTGTGGCGGCTGCGCTTTTCTCCGACACGAGCCACGAGGTCACCAGCGCGG
TGCTGCTACCACCAGCTTCGTACTGCTCCTTTTCCTTTTCAGTGATCGGGCGCAGACTCTCAAGGCTCGAGTTGAGAACGTTGTATGCGTACAGGAACAT
GTACGACGACTCCACAGACGGGTTCTTTGCAAGTCCAAtcgccacgcgcttgagTGCCTCCTGTAGTGCAGCAGTAGcttgagcaccagcgtccgTAACC
TGAAATCGCTTCACAAGAGCACTCACAACCTCGTGAATGCTCGGGTTGGGCAGGAAGGGTAGTGACcttgccagcagctccagtgaGTCTAGACTTCGTC
CACCGCTTGCGCGTGCCTCTTTCATCTTGGACTTCTGAACCGTCTTACGTTCTACGCctccagcggcggcttcCGCTGCCTCGCCGATTGTCGTCATGCC
CTGGAACAACTCTGCAGCGAGAATTTCCATCAGGCTAGGAACGCAACCATCCAGCGGAGACGCAAACTCAGCCTCGTGCTGAGCCTCTTGGTCCTTGTTT
TGGGTAAGCAGCAACGACTGCGGCTTGCGAGGGGTGCCTGTCTGTCCTTCTGTCTTCATAATATGCGGAAgcttttccagcagcgcatgcaCAGTAAATG
ACAGCACATGGACCATGTAACCATCGCGCAGGGTGTGACGAAGTTCCTCCACAATTGGTAGCAGGAAGCTCGCACCAAGTTCCACAGCGATTCGAACGAG
CGTAGTACGGGCCGAAACACGCACAGCCTCATCCTTACTCTTCAGCAAGTTTGcgaacttcagcagcaacttgggCAGCTCACGTTGGAACGTTTCAGCG
CGCagtcgacgcagcaccttcacgACCGCAAGCGCCAGAGGCACACGCACCGAAACAGCTTCCTCGGAGAGCGAGGTCGATTCACCGTCATCATTCCGCG
ACTTGGAGCTCTTCTTGGAAGCAACACCCTTGAACAAGTATGAGTAGAGCATCGGAAGCACCTGTTTCTCCATGTTGTCCTGGACTTTGGAAGAAccctc
ctcttcatcatcatcgacAACGTTACCAGCCGATTTGCTGTCCGATTGTTTTTTGCTGCCAGACGAGGTTTGCCACTGAGTGGCCGCACCAGGTGCCTCG
AAGTGGAAATGGTCGATCACAGCACAAATGGACATAATGATAGAACCTTCCATCTCAACGTGTCCATCGATCGACTTCAGCAGTCTACGAAGCAGCGAAA
GGTAGTGCGACCAGCCCagaagtccagcagcgcttccaaCACAAGCTGCGGCTTCAGCACGCAGAGACTCCTGGCTCTTCGCATGAGTCTCGTAGACGAA
ATGGAGCACGAGCGGTAAAATGACACCGTTCAccgtcgagttcgagaacCACTGCGGCTCATCGCTCTCTTCGCCATCAACTTGATCGTTCGCCTTGGCA
GCCATGGAGTCCATGAGGACACTGAGACGCTGTAGAGCACGGCGCCTGCGGTGGGCCTGGATGTGCGTAATGTTGTAGAAGAAGTCGGCTTCAGGGTCCT
CCTGGTTGCGTGCCAGTATCAGGTCCACCGGAACAAACGTAAACTGTTTGAAAGCCATGTGCTGGTCGGCCAGCGATCCCAGCAACGTCACGAAGCCACG
ACGCGTATTCTCATCCGCCGAGCGCAAACTAGCGCGCACACAAGGCATCACTAGAGACTCCAGTGCATTAAGCACGGGAGATTTGGCGATATCTTCACGC
TCCTTTTGTTCAACTGCAATCTCAGCGGATAATCCAAGGAAAGTCGTCAGCCCAGCAAGAGCACCGCTACGAACGGAAAACTCCGAGTCATGCATGGATT
GCAAACACTGCGCCACCAGGGGTGCTAGCAAGTGCGTCTCGTTTGTAAAACCGGCAAAGCGCGAGGAGTTCAAACTGTTCAGCGCAATGAGGCGGCGCTC
ATAGTCTGTCTCCTCAATCTGCTTGGCATCGTATGCGTTGAGCTCAACCAGCAACTCCGCCACAGGAGCCAGCTCCTTAAACGCAGGGTGCGCCCCTAGC
GCAGTAAACACTGCCACAAGTTTGAGACGAGGATCACGATCAGCAATGCAGTTCGCGCCTGGGGCCAACAGCCGCGCAAGGGCGAGCACATGCTTTTTAG
GTTCCGATAGCTTGAGCACCATGTGCGCTAGCACTTCCAGCAagttctccttgtccttcgGAGACGTTTGGTGGTTGCGCAGCAAGAACGGCAACAGTAA
CTGGAACAGGTCGTGCGCAGCAATGGCGATGTCTCCCTCGGAGGCTTCCAAGTGGTGGGACAGCCGGCAGAGGAAAGTAAGTTCTTTCCGCGAGGATCCT
GCGTACCGGTCACTCGCATAGCGAGCAGCCTTCGCCTGGAAACGCTGCAcgaactgctccagcacgaacggGATCTGTggtatcagcagcaccttaTCAT
CCTTCTTGGAAGCAGTCATAGGCTCGTCTTGGTCCTGCTCAGCCAACATTCGTTCGTCTCCGTCAAGCAGTGAGTCCATGAACTGCAGAATGGAGTCCAG
AATTTCGGGAGAAATGCCACGAGTAGATGTAGACGTCGCGCTTGATGACGTTAATCCGGCAGACAAGCAGGAGATCACGTTGAGTACCAGAGGCTCTGGG
ACCCACTGACGCGCTCGATCGGCGCGGCCCATTGCCACAAGCAACTCCAAAAGCGCTGACGCCTTGCCTGCGCCGACAACCGCATTAGACAAGTGCGTGA
TTGAATCGCGGGAAGTTTCCAACACTGCAACAACCCAAGGTTGAAGGTGCACCAGGGTGTCAAACTGCACAAGCACAACATATCAACGGTCAGTATCGGA
GTCACTCAATGGATGGGATAAGGTAGACTGTTCGTACCGTGTCAATCATTTCCGCAAGCCGGCGGTAGGTCAGCATGCGaatctgcttcttcatcgaggc
AGAAGTCGCCAGCGTGTTCACATTCGACGAGGTCTCGCCGGCCTTTCGCTTTGAGCCGACTACAACCACGGAGTTATCTCcctcggcctcttcctcgttc
TCATCGGCATCAGCAGAACCATGCATACCTTCATTCTCGCTAGAAACAATGCTGATCTGAAGAATTGCCAACAGCACATCAGCAATACGCGGTACGAAAG
CAGCCAGCTTCACACCGAGTTGGTTGATGAGATCCTCCAGAAGATTCAAGAAACCCAATATACGCGAAGGTTGCACGGTAGCAACTGCGGCCACGGGCTT
CACGTCATCAGCAGTGACAAGAGCTCCTGGGGTATCATTCTTAGGAGCTTCAATCGTGACATCAAATGCGCGCACCACCAATTCCACGAAGCTAGCAAGT
TCAGGCGCCTCCAACGCAGCCAAGTATGCTAGGatggcagcacgacgagcgGACACGGTATCACCGTTGTTGCGACCCTTCTTGCTAACACACTTCGAGT
ACAGAACGCGTAGAAGCACAGGTAACAGCTCCGGGCGATGCTCACGAAGAACgacaccttctccatcccCAACCTTAAAGCTTGCGAGTTCTTCACGGAA
CGAAGATGAGTCGGTCAGTCGATTTAGCTGCGTCTTGTACGAAGTGATAGCCTTGTTACCAAACGCGTACAGGCACTGCAACGCCAGCTTCGAGATTACT
TCGTCCGACTTCATTAGTAGATCGAAGAAGAGTGCatgcagcaattgctgcgcATACGCACCCTTCATATTGTGAAAGGCAGCGAAAAGCTTCATTTGAT
CCACAAACTTGCCACGTACTTCCTTGGTGGTCAGGCCCTGGAACTCGACAGGTTTGCGCCAGTCGAAAGATTCggtgtcgttgctgccgttggcTTCTTC
AAGCTTAGCCAGTACCTGGTCGATTTCCGCAAGACGCTTggcatccagctcgtccgtgTAAATGGCACTGTACTGGTCACGCAAAAACGTGAGGAAGAGC
GGCACCATGAACTTCGTCTTGGCTTCTACTAGGTCAGCGAACTTCATGAGTCCCTTCCAAAGCAGATAATGGTGAGTGGCTGGGTCTGTAGCACTTGACG
CAGGCACATTACCCTGCTCCAGCATGCACACACGCTCAAACTCCTCGAGAACATCGCTTTTGGTGCTAGGATGACTAGTATGCTTTCCAGTAGTGTCTTC
ATGTTTGAGGGAAGTCACCAGAAGCTCCGCGCTGATGCACGGCCAAAATTCGTTAAAATGCAACCGAACAGCAGTCTCCATTGTGTCGGCGATGTGCGGC
CAGATTGTGGAGAACTTGACGTGGTACAGACCGAGCAACTGATTTATGGCAATTTTCTTGTACAATTCAGGGGTCTGTGGCGAGCGACACAGGATCTTCA
CTCGCGTCAGCAAGCGCACCACCTCACGTTCAGTAGCAACAGAAATATGTTTGCATGAGAGCTCGAGGTTCACGCAAACGTCCGGTAGATCGCACGGACC
GCTCAACGAACCACTGTCCGAATCAAGGAAATCCAAGCGCTTGAATCGAGCCagaaactgcagcgccactaAGCGCAGCTCATGCGCAGGTGACCGCAGC
GTTGCAAAAAGAGCGTTCGCCACGCGGGGCAACACATCAGCAGTCAGTACTGCATTCTGTTTCTCCTCGGTTTCGATATCAATCAGCATCAACAGCGTTG
ACAGCATCTTGAACGAAGATTCCTTTCCTCTCAGTGCCTGCTCCACATATTTCGTCGTCAACGCAAAAtccttgctcttgctctgGTGCTTGGCAATCTG
CTGCAACTGCCACAATTCGGCACGCAAAGCGGCCACTTGAATCGTTGACGCAGAAGGTTCCTCCTTCAATCGCTCGTTGCACTTCGTGATAAGAGGTGTA
GTGAAGCTAATCAGTTTGGCACCATTCAATTGCACAAACTGCAAGGCCTTGCAGAACTTCCAGTTCGCAGCCACACATTCGATGTCATGTTTGCTTTCGC
TCTCCTTGAAGAGCTTTCGGCCAGCATCCAACAACATATTCTCGGCATTGGAATCAATTTCGTTAAGCGCAAGCAGCCAGTAGCGACTGCTGTTCTTCGA
GCGGACAATGAACGAGCTCTGGTCTGCATTGATTTCTCCTGCTTTGTCGGCGACGTAGTCACCAATCTGGCACAACAGCGAGCTAAAGGCGCTCACGTCT
GTCTTCACAAGTGTCTTAAGCGCGAATTCAAGAGCGTTGGGAATCAAAAAAATGATCACGAAACCCACGTCAACATGGACGTTGCGCAGTTCCTGTCCCA
CAAACTCCAGAAGCTTCTGACGCCAAAACACCTGCTTATCCTCAGTCGCTGCCACAACAAAAATGGCCTTCACCTGGGCGGAAAccacgtcgtcttcagc
aggGAACAGCCGCCAAACCGCTTCAAACGTTTTCATGAGTGTATCTCGCAGTGCCGTACTCTGAGATACCAGCACCTTGTTTTCAGGCGAAACTAGCGCT
GCGCAAGCCTTGTGCACGCTAGGCACGCGCACCTCGTAGGCATCAGTCGCTTCTGTAATCAGCCTGCCCATTCGTGAAATCAAAAACCCGAGCAGAACAC
GCAGCACGCGACTTAAGTACACATCATCCGCCTCCGTAGGCAGCTCATCTTTCTCATGACGAATGTTCGCCACCTTgttcaccaccagcaccacaCACTC
CAGCATCTCCCCGGAGTGGTCCGCATCCGTATGTTTCATCATAAGTCCACAGGTCTGGTACACGATCTGGAACAccacttcctgctgctccaggtgttcc
tgcgtctcctgctccgcctcctccttcggTCGGAACGAGCccagcagaaacagcagcacctcgcgcatGCGCGAGTGGAACCCGTGGTTCACATTCTTTA
CGAGCGCGAAGAACAACTTGGCCGACCCATCCCTCAGAATCTCGTTGCTGCGTCCCGACCCTttcaccagcgccgtcaagtACGCACGCAGGTACTTCCG
CATGGCCTTGGGCGACTCCAGTCGTCTcagcagcacagcgagcgtctgcgcggCGAAGTTGCGCACAAACTCCCTCGGGTGCCCCAGCAAGGGGAAGTAG
TACTTGTGCACGGCGTCCAtgtcggccagcagctgcacccTCAGGTAGTTGAACAGCATCGTGAGCGTCTTGAACACTTGCGTGCTGAGCTCCGGGTCCT
TGGTGtcgaccaccgccaccacgagGGGCAAAGTGCTGGCGAAATGCGGGTAAAACTCCTTGCCGAGCTCccgcgccagcgccgtgacgAGCTTGAGCAC
GGGCACGAGTctctggcgctgcacgacgggGTCCGAGGCGTCGTCTCGAGTCTcccgcagctccttctgcagaCGCGcggccaccttctcgaggtggtgc
agcagctgcggagTGGTGGTcaccagcggctgcagcgcgcggaacaggagctggaagctgtcGAGCGTCGTGAGCTCCGCCTGGAggcccagctcctcct
tgaaCGAAAGCTGCGacgcctcgtccacggcgccCGTCGTCTTGGCGTGCAGCGTGAGCTCATGCTGCAGGTTGCCCACGCGCTCCTCGACCTTCTGGAA
GCGGTGgcgccgcttc