Description :
From Genome Similarity Track
Location :
Scaffold_7:97544- 98732
Sequence
1188 bases(100 bases per row)
AAGAGTGACCTTTGGATGAGTCTCGGTCCAAGAGGACGAACCTACGAACGAAATTTTTTAGCCCTCGAAGACAAGATGCCAAAACATCCTCGACGAAGGT
GCTCCAGCATGTCTTGAAATCTGCCGAAGAGATAGTTAACCTCTCGGATATGACGTAGGATCTGTTCCTGTCCGAACTAAAGGAAGGAAAGATTCCCGAG
ATAGTAGTACCAGCTCCAAAAGAGAACTTGGTGAACTATTGCTCTTCGTCCACAATAGACGAGAGTGTCTTGGAGACCGACAAGACAAAATGATTCGCTG
CTCAAGGCTGGGACGTCTTGAAAATCAGTCCGTTTTACGAAGTTCTGTGGAAGCACCGTGGTGTCTCCTACAGAAGTGTCGACCCGCCTACCGGCCGATA
GGGATATCCGGCACGAGATTGACTTGGAGCCTGGCACCAAGTATTGTGTGACCAGGCAGTGACCATTGCCGAAGGAAAAGGGTTGACTACATCGACCAGT
TCTTCGACAAGAGAGTCAAGGCGAGACATGTACGTGAGAGCAAATCGCCTCAGTGCAACCTAAACTTTGTTTGCGTAAGGCAACAGGTAATTGGCGCGTG
GTCTATGCTTACAATAAGTTGAACACGGCCACCATGCTAGCGCAGACACCGATCCGCGGAAAGATGTCCTATTGAACTGAATGAGGAAGTCAGCTATCTT
TTCCACGTCAAACTTAAAGGATGGCTACTAGCAGGTACTCATGAATGAGACCGATGTAGCCAAGACGGCAGCATCCCAAACGGTATGCTGTGGGAGTGGC
TAGTAATACCGCAAGGGTTAAAAAACGCACCAGCGACATTCAACCGGTTGGTCGCTCATGTCATGCGTCCACACCGTGTATACGCTCCTCATTACTATGA
CGATGTATTCTTTCATAGTAGGGCCGAGTACGGATTGAGTGAGATAGAATTGCACAAACGTCATTCAAACGTTGTGTTGCAGACTCTGGGCGACGATCGA
TTGTACGTCAACTTGCATACGTGCGTCATAAGGGTCCCCGAAATATCTGTAATGGGCTGCATCGTGGGTAAACACGGTGTTAGAGCATACCCATAAAAGG
TTGAAGTTATTAAGGAATGGCCAGTCCCACGACATGTGATGGATCTGCGTCAATTCCTAGGGCTTTCTAATTACTTGCACAATACAGT