Description :
From Genome Similarity Track
Location :
Scaffold_437:9753- 11205
Transcript NameFunction/comments
Pytve_DAOMBR484fgenesh_masked-pve_contig_437-abinit-gene-0.38Nucleolar protein Nop56

Sequence
1452 bases(100 bases per row)
TTCTTGCTCTTCTTGCTCTTCTTCTTGGGCGTCTCCTCCTCGACCGCCGCCTCCTCCTCCTCCTCGGGGGCCGCGCGCTTCTTGTCCTTCTTGCTCTTCT
TGCTCTTCTTCTTGTCCGCGTCGCCCGAGCTCGCCGCCTTCTTGAGCTCCTCCGACACGGCCGTCATGACGTCCGCGTTCTTGCGCGGCGCCGTGCCGCT
CTCGTAGAACGCCAGGCGCTCCTCGACCTGCTCGCGCATCTGGTCGCCGTACTTGGTCGTCGGCTCGTCGATGAACGAGTCGATGCGCGACGCGATCGCG
CACTTGTTGGCCAGGTAGCGCGAGATGCGGCCCTTGTTCTTGGCGGCCGCGCGGCCGATGAACNNNNNNNNNNNNNNNNNNNNNNNGACGAGTGGAACAG
CAGACCGTACTTGGGCGTGTTGCCGCGGGTCTTGAGCGCGCGGAACAGCGCCTTCTCGGCGCCGAGGATCTGCACGGTCGAGGCCGGGCACTTGGCCAGG
TTGGTCAGCGAGCCGGCGTGCGAGATGAGCCGAGCACCGACCGTCTCGCCGATGAGCGCGGCGAGGTTCGGGGCGACCGTCGCCATCTTGGACACGAGGT
ACTCGTGCAGCTGGCGGCGGTACTCGGCCAGCTTGATGAGCCGCGTGGTGAAGTTGTCGACGTTGATCATGTCGATCTCCGACATGTCCATGCCCATGGA
CGAGCGCGCGGCGTGCAGGATCTGCTGCGCCTTGTCCTCGTCCAGCACGATCGACGAGAGCTCCTCGAGGCTGTCCTCCGTGAGCGTGCTGCGGTTCTTG
ATGAAGGCGGCGCAGCGCGCGTACACGTAGTTGTCGTTGACGATCTTGACGAGCTCCGGGAAGTGCCACGAGTACCACTCGCGCACGCGCATGGCGAACG
TGTTGATGTCCTTGTCCATCTGGTCGAGCAGCGCGATGCTCTGGATGATCATGTTGTCCGCGCGGTTCACGTTGAACTTGACCTTGGCGCGCGAGTACGA
GTGGCCGAGACCGAGCTGCGCCTTGCCGAGGTTGCCGTGGTCGAGCTCCTTGACGAACTTGCTAAAGTGGACGCGCACGCCGCGAAGCACCTCAAGCGTC
GTCTCGTTCGTGTTCACCGGCGCGTGCAGCTCGTCCGCGATGGCCTGCGCCAGGTTCTTGTCCTGCACGCCGAGCGCGAACTTGGCCTTCTTGCCGGCCT
TGACCTTGGGCAGGTTCATCTCCAGAAAGTTCTTGAGGTCCTCGCCCAGCAGGCCCTCCGAGATGTTGTTGATGTTCTCCAGCGCGTTCTCCGCCGACGT
GAACGGCTGGAACGCCTTGAGCTTCACGAGCCGCCCGAACGTGCCGAGCTCGCCCACGGCCTGCTGCACCTCGTCCAGCAGCGACCCGACCTCCTCCTGC
TCCACCACATCGAAGAGCGCGTAGCCCGACGCCGACTCGAACAGCACCAGCG