Description :
From Genome Similarity Track
Location :
Scaffold_301:97527- 99404
Sequence
1877 bases(100 bases per row)
TACTGGAACGCTTCATGGAAAGCCAGCCGGGCTACTCTACTTCGTTGTTATGGCGTTGGCGAGTTCGTCTGCTGGGTCGCGTTGCTGTGCCTGTCGTTGC
TGCTGTTCGTACCTATTAACCTCTACGACCTAGTGGAGTTCGTCCTACAAGGACCTATCGGTGTTGCCATCGGATTTATGCTGCTAGTGACGTACGACTA
CTGTTACGAATGGACTCGCTGGGACCTGCTGGGGCCTCTTATCGTCGCAGTGACCGGTGTGATTTCGCACGCACTGCGCCTGTGTGAAGGGGATAACCCG
CTGCTTTCGATGGCTCCCCAGAGTGTGGTCAGTCAAGCTTTGGCTAACACCCAGCTGAACGCTTCGAAGCGTAGGCGTGCCGAGGCTCTCTGCTTGGAAC
GCTTGCAGGTCCGAGGATGGTATCGAAGGGTTACACGACTCTCAAGCGGCGGAAGAAGAGGCCCCTACTACGGAAGCGTTCCTGGGTAACTCCTATGGAA
CCGAGCAATCCACGGACCTTCCTATCGACCTTTCGGGTGCGCCCGAAACAATGGCTCGCCTGCGCCACCAGCGTTGGCCATCCGTTCGCCGAGGACGGCA
AACTCCAAGTCGGGGAGTATGTCCCGTACCCGGGAATGTAGGCGTCGTGCCAGGCGCTGGCGGGCCGGCTTTTGTGACAAGGGACCTCGGCGAAGGTCAA
CGAGCTGCGACGGCGAGCGGCTGGTTCCCGTTGACCCCGCAAGCTCCCACTTACTTCGCACAGGAGACTGGTGAAGTTATGGTGTGATTGTATTGGAACG
CTACGATGGAGTACAGGAACGGTGTGCGAGTTCCCTCCTATCGTCTTACGTGGCTGGGGACAAGGCCGGATGCGCAAGGTGGACCGCGTCTCGGACCTTC
CTGTCGCCGCTCGAGGACGGATGTCATGGAGAAGGACTCTTTTGGATCAAGATATACTTAAGCGGTGTCGTGTATAGGAAAGCGAGTTGGCGGTAGGCCC
TCGTTCATTAGTCTCAGTCTTACATTTACTACCTCTTGCCTAAGCCGAGTGAGAGAAATAAACAAGAAGCTTTTTGGTGTATTAAGTTATCTTGTGCTAC
CGTTCCTGCCACTACTCGAGACCGTACTCCCTAAACAGCCGCAGACTACCCGACCCTAGAGGTGGTGTACGACAGGTGGAACCTTTAGGATCTGCAAGTA
AATTATATTTGGCAAAAGGATCAATAAATTCGGAAGTTTAAACATGAACTTAAGTAAGTAAGTAAGTGTACGTACTTAAGTTCATGTACAGTGGTTTTGG
ACAACAGCTGTCGAAAAGTGGGAACATTATAGAGTGCGCATTGTTCGCGCATTGTTCCGGACCAAAGCACTGTAGCTTTATTAATAATACAAGTACAGTA
CTGCACCCCGTTTTCGCAGGGGTGCACCATATAGGATTCGCAAATAAACTATATTTTAGCATATAAATCATTGCTCGTTTAGATTCTGGATCATTACATC
CGGAAGTTTATCAAAGGTCCGAGGACGCGAAAACGGGGTGCAGTACTGTACCGGTACCGGTTACTTGAAGTAACCTGGCATTCCAATGTACTCGAAGTAT
CACTACTGTCAATAACAGTGCTTGAGTTACGACTCGTGAATCACGACGTGATGGCATCAATGACACTAATGTCCAGAGCTTCCGCCTTTTAACGGGTCCG
TTCGATTGTGGTGACTCTGTGGTGTGTGAGATTTTATCGTGAAAAGCCAGGAAGTGGCCAGCGGCGCCTTCAATGTGCTCTGTCTGACCAAATTCCTGCG
CCAAGCTCATCAAGACTTGCAGGCCACCAGTTTGCAGAACGAGGATCTGATTTCCCATACTGGAATCAAGCTGAAAA