Description :
From Genome Similarity Track
Location :
Scaffold_254:9752- 14626
Transcript NameFunction/comments
Phypl_g6014hypothetical protein PHYSODRAFT_323421
Phypl_g6015hypothetical protein PHYSODRAFT_472499

Sequence
4874 bases(100 bases per row)
GTTGCGCTGTACGATCCACTCGACCGCGTCAGGGAAGCCAGTCGCGACGTAAGAGGGCGGAGGGTCTGCGAAGAGCAACAAGTGCATGCATCAGTAACCA
ATGCTCGCTGGACTAAAGCCACTCGCCAAATATTCAAACTCGCACCGATCTTTCCTGCATCGCCGCTTCTGTACTTGCCGGTTTGCACAAGCACGCCGTG
CATGCCTAACTCCATGGCGCCGTACACGTCTTGGcgaacgtcgtcgccgatcATGACAACCTCCGCCGGAGCAACGTTCCTAGAATGCCCACACCGCACA
AATACCATTGATTAACGGACGCGCGACGTGGATGCAACCCAGAAGATGGCGCGGCGCTCACAAATCTTGGAGTGCTTGGGCGTAAAATGTCGGCGCCGGC
TTTCTGTGAAGACAAGTCGTATGTTTCGTTACACAACTGGACATCAAGGAACACAGGCGATAAGCTTTTCGATCGCGTTAAACGTACCCGATAATGGTGG
CCTGTACGCCAGCCGAGAATTCCAGCGCCTTCACAAACGCACCTGGGCCAAGGTTGAGACCATCCTTTCCAGCAAAGTACCTCGCTTCGTGAAGCGCGAT
CAGCGAGCCTCtttcaagcagcacgcggaaCGCCTCGTTGAGCTGCCCCACAACAACGAATCAGCACCATCTACACCCCCACCAAGACAGACGCACACCG
CCACGCACTACCTTGTTGTAGTGGAAATGCTCGGGTGCCAGTCCAACGATGACCGCGTTCGGGTTGGTGCGGTCGAGTCCGTCGAACTCTTCCTCAAGCG
ACGgatcgaccagcagcagcggccgcaggtggcgctgctccagTAAATTGCGCGCAATGCCTCCCGATGTGAGTACATGCTCAGGCTTGATCGCATCGAG
CCCGATGCTGTGTAGCTGCTGGATCTATGGGATATACGGGCTTTAGTCGCCATCTCCTTCCAGTTCCCAACCGTCACCAACGTACGAGCTCGCGCCTAGA
CTTTGTCGTCGTGTTGGTGACTGCCACAAACACGGCGGAAAGGACACAGTGACAGCTCCAAGTCAGTTGACTGACCGCCAGCGCACACGCGCCATTGTTT
GTCCACGCACCAAAGCGCACGCCGACGTCTGGGcggctcagcagcttcgagagcgCTGCCGCGCAGCccggcagcacgacgtccCCCACGTGCAGCGTGC
CTGCGATGCAGAAGACAAGGCAGCGATCAACATCAGCGCGGCGGGGGGAGAGTGCAGCGCAGGGCTGCACGTTACCGCTGAGGTCGATGAGCACGCCGCG
GATGCTCGCCATGCTCACTCGGGAGCCAAAACTGCAGTGGGGCGAGTTCATTGGCTGGATCTGCAGTGGGATGAAGTGGACGATCGCGGTACCGTCCATT
AGCTGACTGTGAGCGGTGCCACCATGAGAGTCTCGCAAGGCTCTGCTGGCAAAACCACTGAACGCCGCTTGGACAACTGCCGAAGGCTGAAGTGTCCCAT
TCTCGATACCTACGCGGTAGAGCCGCGTAGGTATCGACATCGACTCGCTTGTGTCTGTCAAGGAGACATGGTTCACTTGACCCCGCACCGAACTGACACG
CCGTTGGCAACCCGCCAACCCAAGCAGAGCTGTACCATTTGCCAGTCTCTGATACGGTATCACTGATACCCGGGGCTCGTCATCGCGGCGCTCATTGGCT
GCCAAGAATATAGTGCAACGGCGCAAAAACATGGCAATTGCCAGTTGCTTCTCGCCATTCCGCAGCTTGCCTCACGCGCAGCAAGACGGTGTCAAGCAAA
AGGCCCACGGAATATTGGTGAGTGGCGTCTGGACTCTTCCGCCGCATCGCTGGCCATTTAGGCGGCGTCCGTTATGGCAACGGGGTGCTGACTTGTGTCG
GTTGCTGTCTGCCTGTGCCATTTTCAGACTGTCCCTCGCTAATAAAACGAGAAGCTAGCGGCCATGCCGgcctccaagaagcgcatcCAGAACCGCGGCA
CGCTCAACGTGGGCACGCAGCAGGTGCCCGCGGCGCTGAAGGACTGGGTGCACATTTGGCACGGCGTCAAGGTGAACAATGGGTGCGAGGACACGTCCAT
CTTCCACTCGGGCTCGCGCGTCGAGGAGATGCCGTTCTGGAAGCAGTTCATCCGCTTGCCGTCCAACTCGCTGTTCCCGAGGGTGTTTACCAGCTCCAAC
CCGAGAAGGCCGTACAAGGACTTCCtctacgtgctgctgaacatGCGCTGGcccatgctgctgacggtgctgctggcaatTTTCCTGCTCaacattttct
tcttcgcggcgATCACGTGCTTCGTCTGTGGCGAGCCGACGCATTTCTTCGAGGCGTTCGACTTGAGCTACCAGACGTTTACGACCATCGGATTCGGGGT
GGTGTACCCCACGCACACGTGCGGGAACGTGAGCATGTCGGTCGAGTCGTTTGCGTCCATGATGGTTGTCTCGGCCGTCACGGGTCTGGTGTTTGCCAAG
TTCGCCAAACCGCAGGCAAAAGTGGCGTTCAGCAAGGTTTGCGTTGTACAGCCGTATGGCAAGAAGTATTTGGCACTCGTGGTGCGAGTAGCGAATGCCA
CCCAGTCCCGAGATGTGACCCACGACGTGATCATGGAGGCGGTATTCAAGGTCAATTTGCTGCGAGTGGAGCACAAGACGAAGCATATCCGGGCACATGA
TGACGAGGTCTCGCAAAAGCGTCGGCTCTCTCGCGTAGCAGCTAATTACGTGATTCCAGACAGTGAAGATGAGGTGGATGATCCCGCGTGTTCGCCTGCG
AAAGTGTTAACGTCGTACAACCTCAAATTGCTGCAGAATAACTTCATCACATTCCGCATgggcgtggccgtggtgcACGTGATTGACGAAAACAGCCCGC
TCTACGGGATGTCCAAGAGTGACATTGCTCAGTCGGATATGCTTGTGGAGGTTGCCATGTCAGGCGTTGATTCTACCCTGCAAGACACCGTTTCCGAGCG
GTATATCTACACGGCAGCAAATCTGATGTGGGGATACCGTTttgccgagctgcttgatTTCAATGAGAAAAACGCAGAGGTTATCATGAACTTTGCAAAG
CTTAGCGCGGTGGAAGCTTCTCTAATTGACGATGCCCGCTACCTCAAGCCGATTTTCTCGAACGGTAAGCCTCGAGACAGTCATGAGAGCGGATACACGC
ACAATGTGGCCGACAGGCGTTCTCATCGGAAGTCAAGAGTATCTCACCACCAGGAGGAGGATCATCCTTACCATGACGAAGCAATCCATGAAGTTCCAGC
GGAGTACACAGAGCCTATCATGCTGAGCTCAAGGTCAGGATCGTGGGATGCGCAGTCATCAACGGACAATGCCCCACCTGCTCAACCACATCCTCCTGTT
TCGTTCTCTAAGAAGCCTGGCCCAAAGAAGTTTGCTATGGGACTCGAGCCGCTCTTCGAGCCATTGCTACAGCAGCCGTTTGGAACACAGCGAATTCCAA
AGGCCCCGTCCGCTGAAGCCCGAGCTGCTCAAAGGGGGGGATTGCGTGTACGGAGGGCAGGTGAACAGGCAGATGTGGGGGAAGGGCGACGTAGGCGTAG
TGGACAGCAGTTGGCAGCAGATGACGACTCAAGTGATCGACGTCGCGGTAGCAGTGGAGCCGCGCATAACAACGAAGGTGATCGCGGCTCGTTTGAAGGC
CCGAGTGGTCTCCGAGTAAAGAATCTGCTGCAAAGAGAAATGGCTGGATCGGCACTGATGGAGGACGACACCAGCACAATTTCACAAGAGGAAGGCCACA
ATGACTATTTGGAGGGCGCGGACGATATGGATACCGATGGTAGTGAtggcgagagcgacgacgtggaggaagAGTACGACCAAGATGCTCCCATTGGACC
GCGCATGCGAGCTCAGACGTCGGCGTCTGCTGTTTCGATTGAAGTGGAGGACACACCTCGATTCTTGCGAATCCTGCCTGTCCATATTCCCAAATCATTC
AGCTTCATGCGGTTCTACCAGAGCGCTCTCCACGTGGGTTGGCCGAAGATCAtcgtcgtgttcgtgctgtCGTTCCTGGTTCTCAATTTTGTTTTCGGCC
TACTATACTGGTTTGACGTTAGCCACATCGCAGCGTATTCCGATATGGTGGTCCCCGACTACGAGCTGGCTTTCTATATGAGTGTTCACACACTTGCCAC
GATCGGCTACGGATCCATCGCTCCGATGCCAGACGCAGTCTACATGAACGTCGTCGTGTTCATCGAGTCGATGGTGGGGATCATCGCTGTGACAATCGTC
ACAGGCATTGCCTGGTCCAAGTTCGCGCGACCCCGAGCACACATCCACTTTTCGTCGAAGATGACCATCTCGACCATCTACGGCCACCGTTGCCTCGTTT
TCCGAGCTGCCAACACGAGGCACTCAGGCGAGGTACACGAGAACTTCTTCCGCATTGGTGTGATCCTCACAAACCGGCGCACGGGTCTCCGCCAAATGTA
CGACGTGCCGCTTGTGACCGCTGAGTGGCCATCTATCAAGCTTCCGGCGACGCTCATCCATGTCATTAACGAGAACTCTCCGTTCTACAAATTTCACTCC
ATGGAGGACCTATCTCAATCGCGTGTCGCAGTCATCGCGTTGCTTACGGGTCTCGACACGACCTTCTCGGAGAACGTGTACGCGCGCAAAATGTACTTCT
GGGATAACTTTGCGTACGACATGCGTTTTGCAGACTTTGCTGTCATCGAGCGTGACCGTGTGATCGTAGACTACAAGCGCTTTGATCGGCTCATTCCAGA
GGACCGAGACGAGCAGGTTATGACCACGCCAGTGCTCTCCGTGAGGTCTTCAATCGCTGACTTAGTGTAAACTA