Description :
From Genome Similarity Track
Location :
Scaffold_403:975- 2566
Sequence
1591 bases(100 bases per row)
ATGGCTTAGCGCATTCCTGACCAAGTCGATCCATCAACTTTCATCGATAAACGAGGTTTGTTTTTTACAAATATCATGCCAAACTGCAGTACAGTGGAGT
AAAAGAATACACATACCCCGCGTAAGGTGATATTTTAGGTGAATGTTACCTGTGGCGGCAGGTTGTGTGGAGCCCCCCCAAATAGCTACATTCGAGCGAG
CTAAGTCGAAAATTTGCGTTTGCCGATCAGAATTTAACGATAGAAAAAATAGATTACCGAGGTGGCTGCCTCTACTGTACAGTAATGTGCGTCAATAGGG
ACCTCTGATATGAATAGGAGTGTAAAGGCTATTAAGGCGAACAAGTGGAAAAAGAAATAACAATGTATTGATTTAGTCAAGAATAAATGACACACTGCTT
TTACTAATGAGCGTGGAGTGCAACCAGCACTTCTGAATCGTAGAAGCTGACACATTATCCCACGCAGACTCGCACCACTTCATGGCAGTTAGTAAGTCGA
CTGTATGTCTAGGGATGCCCAACTTCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNG
TGCAGAGTCATTTGATAGATAATGTATGACTTCAGCTATAAAAGCACTCATTGTTCTCTCATTGACCACTAAACCAAGCAACAGGCTTAGTCCAATCTAC
CTGCAACATGGAGATGCCGCTACACGCGATTAATACAAATGCAGCAGGTCCCTACCGTACTAACTAACTAGTTATAACACTCGATCCGTAAGTCCAACAC
TGCGTACTAACCGGCTGGCTATCAGATACGACACTGAACGTGCCGTAGCTACCGGTGCGGCTGATCAGTGGTGGTGTTGGTCAGGAGCAGC