Description :
From Genome Similarity Track
Location :
Scaffold_2368:975- 2096
Sequence
1121 bases(100 bases per row)
CTAGCCTTGAGGATGACTTGCCGCGGTTGAGATCAAGATCAGTGGATGCTATTGGTCGCACATGCATTAAAAATCCAGCAAAAGGGTATCCATTGAGTTT
GTATTATTCACTTCAATTTGATATCCACATCAATACAGACGTCCTGACCAAATTTACAGTTTCTATTACAGTTTTGGGTCTGTTCAACACGGTACTGTTT
CGCTCGTCACGGGGTTGTTTTTGGGTGGACATGTAGCATCCAGGGGTGAGACGCTCATGGATGCCGCGAAGATCCTTCAACGTTCGCTTTGTGGAGCTAC
TACAGACAGTCAACTACGTTTACCTGGGGTCATTTTGCGTTAGATTGAGGTTATCAATCCGAAGACGTAAACCAACAGATTCGGGACAGCGGTGCGTTCA
TTATTGGAATCCACAAACGAAATCTAAGCTTTCCATTCACGTATGAAAAAGCAGGAGGAAAATTGCAGCGAGTTGTAAACGAAAGGTCCACCCAATGGGC
AACCTCCAAGTACACAACTCGCACGGCGGCTGGATCCACGATCATCGCAATGAACGCGCTAGCCAACGTCGATCTGTGCAACACGACGGTCATCGCGGCC
GGCTTAGGCAAATAGTCTTATGTGTCGAAGAAACGACCCGGCGTGCAGCCCATTGATGCCGGATGCCGATACATCATGGCTTGCAGACTTTGACATCCGT
GTCGCCATGCTTACAGAACCGCAAGGGAATCCGGATTGGTTTTTAATGAGAAAGTTTCGGATTACAGTGCTGGTAGCGATCAGGGTTCTTAATGCGATTG
CCAAGCTATCTCAAGAATCTGAAAGAGATGATGATGGCTGAGCAATGTGTCGAGAACTAGCAGAGAGGAGTGTGATCTGATTTATTATTCGTCTGTTGAA
CATTCGAGAAGTTGCTCAAGTGCATGCTCAAGATACACAACGAGTGTCACCAGGGGCAAATGTCCAGGAGTGTGCTCGACAAAACGAAAAGAACAAAGAA
TTACAGCAAATGTACCGAGATCGAGCTATTCCGCTATGGCAACAAGAATGAGCTTGTTGACCGGCGTCTGAGCTTTGTTAACCCCTTCAACCCGGCTGAT
TTTCACAAGTCTGAAAGTGTA