Description :
From Genome Similarity Track
Location :
Scaffold_41:97482- 98811
Transcript NameFunction/comments
g12606.t1hypothetical protein

Sequence
1329 bases(100 bases per row)
GAGGGCATCGAGGACATGACGGCGCTCAACTACCTGCACGAGGCCGCCATTCTGTACAACGTCAAGAAGCGCTTCCTCCAGGAGCTCCCATACACCTACA
CGGGGGACATTTGCATCGCCGTGAACCCTTATCAGTGGCTGCCTGAGCTTTATTCCGAGCAAGTGCAGTCCCAGTACCTCACCAAGGCTCGGAATGAACT
GTCGCCCCACGTGTACGCCACGTCCATGGCGTCGTACAACGACATGAAGCGCCACGAAATGAACCAGTCAATTCTGGTGAGTGGCGAGTCTGGTGCCGGG
AAGACCGAGACGACCAAAATCCTCATGAACCATTTGGCCTCCATCGCGGGAGGCTTGAACGACTACACGATCAAGAAGATTATCGAGGTGAACCCCCTAC
TGGAGTCGTTCGGTAATGCCAAGACGGTGCGCAATGACAACAGCAGTCGATTCGGCAAGTTCACCCAGCTCCAGTTTGATAACGCGGGCATTCTAGTGGG
AGCCCGATGCCGCACGTACTTGCTGGAAAAGACCCGAGTGATTTCCCACGAAGAGATGGAGCGGAACTACCACATTTTCTACCAGCTGCTGTCTGCTAGT
GACAGCCAGGAGCGGTGGTTTCTGGATGACACCAACGAGTGCTATGCGTACACGGGCGCTAACAAAACGATTAAGATCGAAGGCATGTCGGATGACAAGC
ACTTCGAGCGCACTAAAACCGCGCTTGGACTCGTTGGTGTAACGGAGCAACAGCAAGAAGTTCTCTTTGAAGTGCTTGCGGGTGTACTGCACCTTGGACA
AGTGCAAATTCAGTCGAAGAACAATAATGAAGAGTCAGCCATTGTCCCTGGCGATCGAGGGACGAAGCATGCAACTAAGCTCCTCGGTATTTCGGCAGCA
GACCTGGAGAAGGCTCTGTGTTCGCGGCAGATCGCCGTCGCTGGTGATAAGGTGACGGCCTTTTTAAAGAAGGATCGAGCCGAGGAATGCCGTGGTGCGC
TGTCCAAGGCCATTTACTCTAATGTTTTTGACTGGCTCGTCGCAACGATCAATACGTCACTGGAGAACGACAGGAAGATGCGCCATCACGTCGGAATTCT
CGATATCTTTGGCTTCGAGCACTTTAAGCACAATTCCTTCGAGCAGTTTTGCATCAATTACGCCAACGAGAAACTCCAGCAGAAATTCACACAAGATGTC
TTCAAGACCGTCCAACTGGAGTATGAAGCTGAAGGTATCATCTGGAGCCATATCGACTTTGCGGATAACCAAGATGTGATCTCAGTGATCGAAGATCGCC
TCGGTATTATTTCGCTGCTTAACGACGAA