Description :
From Genome Similarity Track
Location :
Scaffold_259:9746- 12322
Transcript NameFunction/comments
g10291.t1POM66359.1 Secreted RxLR effector peptide protein [Phytophthora palmivora var. palmivora
g10292.t1hypothetical protein
g10293.t1hypothetical protein

Sequence
2576 bases(100 bases per row)
TCGCCACCTCAGCTGCTCTCAATGCTTCGTCAACCTCATTCACCGCCAAGTGGGCCGTCGACAGCTCCATGTAGAGCTCCGCGACCCCGGTCGTGAGTCC
GTTAATCTCTCCTCCTTGAGCCGTTACCGCCTGTTTGAGCACCTTGAGGTTCTTCTCCTTATTCCCCAACTTCTTGTACCCTTCTGCAATCCTCATCGAG
GCCTCAATGTACGCTTCGTGGGTCGTTCCGAGCCCCTGTTTGACGTGTTTACGAAGTGTTTTGTACTTGCTGATGGCCTTTTTGTACTGCTCTTTGGCCA
TATACGCGTCGGCCAAGCTGCGCAGCGACAGCCCGAGCGACGGGTGGCTGTCCCCGTAGATCTTCTCCACCATAGCCACCGAGTCCTCCAGCACTTCAAT
GGCTTCGTCGTACTGCTTGGCTCGGATGAGCACCGACCCATAGTCGTTCAGGATCTGCGCGTACAGCGCCGCGTCCTGTGAGATGTCAGCGGGCTCCGTC
ACGGTGTGACGCGCCTCGCCGAAGACCCGTCCGTGCAGCAGGGTGATGGCCCCGCGCAGCTTCTCGATGGAGCCTTTGAAGTCTCTGGCGTCGTTGAGCT
TCATGCCAGCGTTGCGCAGGCCGCGGATCTCCTGGATGGTGGGGTCGTTGTCGCGACTGCTGGCGCTGGACGTGGGCGCCGGCGTCTTGGGCTCATTGTC
GTCGGCGTGTGCATAGGCCACGAGCGTCAGCAGCACGAGCACCCACAGGAATGTTGTGCGCATGGCGGACTCTAAACTGATACTTCGAAGTAGCTCCTTG
GGCCACGTAAGTCGCACTTAGTGTAAAGTGGCTACACCTTGTTTTTCTTTTCTTTTTTCTTGTTAAAGTGGCTACATTCTGATGGCCAAGAAGAGCAAGA
AGGCGTCGAGCGACGTAGGCTCCATGGATGGGAAGGAGGCCAAGGATGGAGGTGGTGGTAGAGGGAAGAGAATTTCGAAACTGTTTACTGCAATGCAGGA
GAAGGGCGCAGCCTGGTATGACCGAGAACGCGAGGGAATCGCGCTGATCGAAGGCTTCCAGTCGGCGTTGCTGGCTATGAGAGCCGCAGTTGCTGATGGG
ACTCAGGAGAATGATGAGGGGTTGAGTGGACTCGCTGGGAATGTGGTGATGGATCCGTGGCTGGCGGAGGATCTGTACCAGCAGGTGCACGAGCTGTCGA
GTGGCTTTCAGAAGCTGCTGGAGGACATGTACACGCTGCAGACTCGGGCGAGAGACATTGGTGCGTGGTCTTCTTAAGGTAGAGGTCTCTGGGTGGGGAG
CTCATGCTGATAGCTGCTTTAGTTATGGCTGGTGAAGGTGAGCAGCAAGTTGAGGCGACCGAGTTGAGGTTGGTGGACTACCTGCAGATGATGAGTCAGG
AGCTGGCAACGTTCGAAGCCGAGTACCAGCACATTGTACGTTGTAGACCAAGCGGTAGAGTCAGCCACTGCGTTGGATAGTCATCTGTTTGATGTTCGTC
GATTGCAGGAAACGCTGCTGCAGCTGATCTCATTCGAAACCACCACGGATGAGCTGCGAACGCTCGTCATCTCCTGGAGCACGTCGCCCTTCCTCGACCC
CGCGCAATCGCGCAACTTCATGCAGGTACCATGTCCAGTACAAACTGCAGCATTTCTAGCAGTCGTCTAACTCGTTCGTCTTTCTGTAGCGTCACCAACT
TTCTCAGCAGCTGCACACCTAAAATCAAATATGCAGAGACTTCTAGAGATAGTATAGACCATATTTGCCACGCTCTTAGCTCATGCGTATCCTTACTTTG
ACGACACAAACTGCGCGCACAGGTCGTTCACATCCTCGAGACTCAGACTCGACACGAAGACTCTCTGCGCCTTGTTCAGCTCCCGCTGGATCTTGGCTGC
CTCCTGGGACGAGAAATAGGGCGCCAGGAACTTCTCCAGCGCGTCCTCCACCGAGTCTGTGGCCTTGATGACACTCTCCTGTCCCGCAGGGAGGAATATA
CCGGAGCTCGCGGGCTGCGCGGACGGTTCGTCGTCGTACTGAGAGGAAGGAGTTGGAGAGGTTAGATGATACTAGGGCAGTACTGAGAGCTTGAGCTTCG
CGATTGCGAGCATTTAGAAAACGAAAAGGCTCACAAGAGCACAACGTACCATATCGTTCCATTGCACGCGGCAGTGCGTCTTCTTGCGCACGACAGGGTA
GCGCCCCAGTTGGCTCATGAACTCGCCTTCGTTCATTTCGGAGCTCTTTTCTAAATAATGGCGTTCCAGCAACGTTAATGCGGCCGGTTCAGCAACTTAC
CCTTGTTAAGGCAACATAGTTTTTTTTATTGGATTTCATTAACCCCTACAACCCTATATTCTGTATAATACAGAATTCAAACTTGAGCCGAATTTCCCCG
TGAATAATTATCAGGAAGGTTGATTCTGGCAAGCTTTTCCGCATATGCGATTTTGTATGTTGAACAGCGCATCGCATAGGTACAAAACATAAGCGTACCG
CGATTAGGGATATTAAAAAATGATTTGTATTAAAAGCAGAGGTAAAGATGAAAGATTCACGTACAAGCGAAGCGAC