Description :
From Genome Similarity Track
Location :
Scaffold_7:974274- 980353
Transcript NameFunction/comments
Phypa_INRA-310PPTG_05336U3 small nucleolar ribonucleoprotein
Phypa_INRA-310PPTG_05337glutamate decarboxylase
Phypa_INRA-310PPTG_05338hypothetical protein

Sequence
6079 bases(100 bases per row)
TTGCAATGGAGGAGGTGGTGCCGATCAGTGTCAGCGACGCGAACTTGAAGGCGCCCGAGGAAGTGTACGAGAAGAAGCGCAAGCGCGGCGAGGCTGTGCT
GCAGTCCAAGGAGGAAATGACTCAGACGGAGCGCAAGGCGCTGCGCAACGCCAAGAAGCACGCACGGAGGAAGGAGAAGCGCCAGCGCGAGTTCGACGAG
CGGCTGGTGGCCAAGCTCAACCCCGGACTGGGCAACAAGTACGAGAAGAAGAAGATGCTCGAGAGCATCGCTGGCGCCAAGAACATCACCACGGGCAAGC
AGATCGAGGGCTCGTCCAAGCAGTTCTCCAACTCGAAGGAGTTCTTCACACGCCTGCAGGTATTGTACGCTTTGATTGCGCCTCGATGGCGTGTCTACTC
TTCGTGAGCGTGTGTGTTAACCTATGCCATTTGTGTATCGTTGCAGGACGAGGTGCAGGAAAAAATCAGGAGTGCAAGCAGCAGCAAGTAGAGAGACGAT
GCCTCACGTTAAGCGGCAGCTGGCCGCGTCTTCGAGCAATAGAATGGATTTTGTGCATTTTGTACGTCGGGCTTGATCGTCGATGCTCTTTTGCCTCGTC
CCTTCCTCGCCCACAGCTGCATACTGGACGCCTCATGATGAGGCTAATTGCCGTCATCCGTCCCGTTATCCAAGCTGGATGTGTCATTCTAGAACTGATT
TGCGTGCGTATTTGCTGCGCCTGAGCACCGGCATCCTGGCATGATTTTGAAGCACAAAAATGAATCTCGGATCAAAGTGCACAGCGGCTATCTTGGCACT
TGCAATTTGTATGCTCTTCACTAAGTACGATAGTGACGCAGGTGGTTGAAGGTGAAAAGATCGCAGCCACCACCGTCTCATTTCCGATTTTGCCGGCTTC
CGACCAAGTTCTCCCACTCTCGTCTCAATTCGCACCATGCAAGTGAGCACGCGCAAATATTCTGGCGACGCTGGCGACACGAAGCCGGAGACGGAGGCCG
TGTACGGCCACCCGCTCATGTGCGCGAGTCTGCCCTCGGACGTGTTCCCGCAGCGCTCTGTGCCCCCGCGCGTGGCGCACCAACTCATTAAGGACGAGTT
GGCGCTGGACGGCAACCCCAAGATGAACCTCGCGTCCTTCGTGACCACGTACATGGAGCCCGAGGCCGAGGACCTCATGGTCGAGGGGCTGCGCAAGAAC
TACATCGATCTGGACCAGTACCCGCAGACGGCCGAGATCCACAACCGCTGCGTGACCATGTTGGCCAATCTGTACCACGCGCCGCTGGAGCCCGGCCAAA
AGGCCACGGGCACGGGCTGCATCGGCTCCTCGGAGGCCATCATGCTGGCCGGCCTGGCCATGAAGCGCAAGTGGAAGGACCGCCGTGTCGCCGCCGGCCT
GCCGTACGACAAGCCCAACATGGTCTTCGGCTCGAACGTGCAGGTCTGCTGGCACAAGATGTGCAAGTACTTCGAGATCGAAATCCGCGAGGCTGATGTG
TCCCCGGACTGCCTCGTGCTGACGGCCAATCGCGCACGTGCCCTGCTCGACGAGAACACCATCGGCGTCAGCGCCATTCTGGGCAGCACGTTCAACGGCG
AGTACGAGGACGTCAAGGCCATCCACGACATGTTGGTAGAAGAGAATGAGCGCAACGGTTGGAACATCCCGCTGCACGTGGACGCGGCCAGCGGCGGCTT
CATCGCCCCGTTCCTCAGCCCTGAGCTCGAGTGGGACTTCCGTCTGCCCAACGTTAAGAGCATCAACGTCAGTGGCCACAAATTCGGCCTGGTGTACGCC
GGCATGGGCTGGGCATTGTGGCGTGAGCCCGAAGATCTCCCGGAAGACCTGGTGTTCCACGTCAACTACTTGGGTGGAGACCAGTCGTCCTTCACTCTCA
ACTTCTCTAAGGGAGCAGGCAACGTGGTGGCCCAGTACTACAACATGTTGCGGTTCGGATTCGAGGGATACCGTCGTATTATGGAGGCCAGTATGGAGAA
CGCACAGCTGCTGCGTGGAGCGCTAGTGGCCACGGGTCACTTCCGTATTGTGGACAAGCAGCACATGCCTCTAGTGGCGTTTGCACTGATCGATTCGTCC
CGTTACACGTGCTTCGACATCCAAGACAAGCTCAAGAGCCGTGGATGGATCGTCCCGGCCTACACTTGCTCCAGTGGTGCAGAGTCTCTGGCTATCATGC
GTGTAGTTGTCAAGCAGAACTTCTCGTCGCACATGGCCAACATGTTGGTGCAGGACATCATGAAGGCCATCGAAGTACTGGAGAAACACCACGTCTTGGT
GGACACGGCCATGTCGTCGCCCAAGGCCGAGAAGAAGCACTTCAGGGACATTGTCCACTCGCTCCAGGCCAACCTCAAGCACCAAAAGTCGGGCCTTACG
ACGCACGGTGTGTGCTAGAACTGTTCTAGCACACTATAGCGCCTGCAGACACGCTCAAAGTGCTGCTTCTTTCGCGCATTTTAGCTGTAGTTTCTACATG
TAGCAGTGAACGACGCGCAGTTCACTTTTCGCAAGGAAAACTAAACATAACATGCAAGTATTCAGTCTTCATTTATACTACGTTAGTGTTTCTAAGCGTC
TTCAGGCGACAGTGGCAAGTATCGACGGAGAAACTGCATGAGCTTCGCTGCAGGCTTGACGAATGGATCGGGGAAGTAGAACGTTGCCATGGCGACAAGC
GCCTCGCAGAACTCGCTGTAGATCAACTCGAGCTGCTCGTCATTGCCTGGTGAAGCCTCTTGAACATTGCGGAACACGTTCATGGCTTGATCCATGGAAA
ATCGAGCGCGTATCAAGTGATAGTCCTGTACAAACGCTTGCCAATCGACCATGCGCATGTACTTGTTGATCCCGTGTCCAGTATGCCGTGGCTTTGGCTT
CGCTATTTTACTTGCAGGCACCATGAGCTCGCGTTCCTTGGCACAATAGCGTCGGAATATGATCCGGATTGTTTGGGAATGACTGCTGATGGCGAGTTTT
ACGTCCGAGCGGTGCATCATAACTCGAAGGAGACTTTGGTTTTGAAGAGCTATCGGTAAATGATGAATGACAAAGTACTCGACACGTGCACTCAATGGAG
AAATCTGCGGCTGGAATTGCTCGTTGCAAAGCTGAAGAAAAAGTTCCGCCAGGTCTTCAGGAGAGAAGAGTTGCTCGTATCCGTTGGCCACTAGTTCTTC
ATCTCGTAAGACGGGGAGGACGTGAATCTCCCGAGGTAAGCGAAGGATCTTTACAATGTGCCATAGATCGTCGAGACTCATGGCGTGTTTGATGTTAGCG
CGGAACGGAGTGTACAGTCGACGTATAACTTGCTGGTGTTTCTCGAAGACGGCACGAACTTGAATGAGTTCAATGTCAGGGTCCTCTTCGACGCTGAATA
TCCGACGCATCGTGTTGTTTGTGAGGGAAATGCACTCGTAAATTTGCTCTCGATTGTCTGATGGTCCGACAGGATTCGTAGGTGCTGGAGATTCTTTTGC
TTTTGACGAGTGAGAAGCCAGCTCGCTTGCTTGCTGCCACTGAGTGAGTCGGAGTTCTTGGAGCTGTTGGTGCATGGCATTGAAATCTTTCATCTTTATC
GATGTGGTTTTCACACATTTGTGGATGATTTCAATACTTTGGGTCAGTTTATCAGTGAGTTCGGGTGAAAGGTGTCGAATTTTGGCAGTATGGTACGTGT
TTCCGTCGCCAACAGGGTTACTCGCTCTTCGGTTAGATTTCTCTTTTGCTGGTGGAAGTAGCGAGCTGTGCGATGAAGGCTCAAACTGGTGCTGCAGTAT
CGGACGAATGGGAATTCCCAACGGCGTTCCTTGTCCTCTCAACGAATCTCCATTATTATCAGTTGAAGAATCCACCGCGGGTTTCTGCGTTAGACTACGA
GACTGCACCACACCAGCAGAAATGAGCTGCTCGGATAGTTGATTCCACGTGTTGTATGCGGTAACAATCGGTTTGATGATCCGAAGCGAGTTATCCATCG
GTTTAGTGGACTGTGGTATGATAGATTGGTCTACTGAAGGCATTGGAGAGCTCTGCGCTGGTGAGGACGTTGCTAGTTGATCTGTCACTGCATCCGGTTT
ATCCGCGTTATTATCTTGAGAATTTACGACTTCAGAGCCTACAGAGACCTTGGGTGGGCTCATGTAGGCGTTGTGTGTAAATGCGCTCATGTCGCCGGGA
GAAAATAATAATGAACCATATCCAGTTGCGATGTGCGCAAGAAGTAGTATACTGAATCCGCACGAGTGGAGAGGAGAAATGTCGAAATCAGCTTCATGAA
GCATTTCAAGGTTCTCAAGCAACGGTATCTGTGGCGGTGGGCGATCCTTGAGTGACAAGATCGATTGGCGTTGTGTAGACGCACGCTTAAACTGAGAACC
ACGTGACGCTGTCCTCGGTTTTTGCGCGGGTATACTTGTTATCCAGCTGCGCTTGACTCCGTTGATCACACCCAAGTCGCCTTTGTCTCTTCCTGCACAC
CCTTGGAGTGCCCTACTAGGCATAGACAGGGTCGGCACAAGGGAAATTTCGTGGCTTTCAAGCATCCGCGAGCTGAATAACTTGGAATGACTGGCATAAT
GTTCATCCTGAATCCGGATGGCGCGCAGAAGCTGCTCGTATTCTCGAGTCACTCGAGCGTTCTCGTGCTGACTCAGTGGTTTATCCTCTAACTCTCGAAA
TTGCGTTGAAATGAAGAGAACCTTCGCATTAGGTGCTTGTATTTGCGCACGAAGAGAGCTAAAGAACTTCGAAAACCTCCTGCTGGATAGTTCGTTGTGC
GAAATCGCCCCTGCAACCTTCCTGTCAGAAGGACTACCTATTGCCGCTGTTACCACTGCATCTTGTGTCGATATTGTCTGCCCATTTTCACTAGGATCTG
TTCCAATAACAACCGAGTTAGACCGCCCTGTAGTGGCGATAACTGAATTGGTTCTTCCTTCTTTAGTCGATGGCATCGTGGAAGACTTTCGCCTCAGCTC
CGTGTTTCGTAGCCGTGCGATTTCACTTAAACATTCAAGGAACACAGAGGGAGTTCCTTGAGACTGCTCGTCGTATTCATCCATCAAATCTTCTTCTCGA
ACGGAAGCTTGTTGGAGAAATCCAACACCGTGATAACCCCGCAACAACGACTCCAGGATAAGTGGTGGAAGGCAAGCCACAGCTTCCACTCGTAGTTGAC
CTTCTTGACAGACCTGGGCCTCTCGACGGCGAGTTGTATCCAAGAACGTACTCGCAGCTTTAATCCGCAATTCTAGCTGTCGTGTCCAGTCCTCGGCTTG
CTTGCGATCATCGCGCATTGCCAGGTTGTCAGCCTGTGCACTATCGCGCTGCATTGTGAGCTCGTCTGCCTGCCGTTTGACGACTGTCAAACTTTGAAGA
TCAATTTGCATTTGCTTTTGGATTCTTTCGATCCTGTGCCTGACAGCCTCGCGCTTCCATGATATAAACACTTTTCGGAGCATAGCCCTGGGAGCGCTGT
TGAACCAGTTCGAGTAGTACGTGATATACTTCCTGTTGTTCTGGCCGCAGATCCAAATATTAGTGGTTGCTTTTCAAAAAGCAATAAACAAGGCGGTGAC
AAACCTTCTTTTGGACGACAGCCACAGAGTACCATTCGTGTAGGAGCATGCGTGCTAGTGCGTATGTGCACTCGGTCAAAAAGTGTCGGAACATGGAATA
CACTCTATCGATATCATCAGCTAGAACGTCATTGCGATCTTCCCGCCATTCCCTGGATATGACGTAAATGCACTGAGCACCGATCCAGTCCTTAAAAATT
AAACGACTTACTTATCCTTTCGAAGTGTCTGAAGAAGACGTTTGTGGTGCTTGACCAACGCAAAATACGGTAAGCCATCACGTGTGTAGATGGATTGAAC
AAGCTCAGCACTCAGCACGCGAAACAAAGGTGCGTATGGGCCGAAATGCGGCGTGAGATCTTCTATTCTTTTCGAAATCGAAGATCAACATAATAGAGTA
GTGAATTACGAGTCTTTATGCGGATCAATACAGTGACGACAATATTGACGGAAACTTACCAAGAACTTTGCAGCAAAAG