Description :
From Genome Similarity Track
Location :
contig_8:974231- 975302
Transcript NameFunction/comments
g2001.t1hypothetical protein

Sequence
1071 bases(100 bases per row)
AATATCGGCACTCGCTCTCACAGTCTGCAGACGTTAGCATCAGTCCCAGGCCGCATCAGTCCCTGTTGTACACTGTGGGGCGGCGTTAAACGAGGGCTGT
CGTTTCCTGCTGATTTTTCTCCACTGCAGCTTGGCGTAACGTGATTTCGGCCACCTTTGGCATCGATTTTCTCGCCACTTGAAGGCGCCAGTAAGCTGAG
CGAACGAGTGCGCAAATTACTTCTAGGGTCCACCTTCCTCGGGCTGCGCTGACGAGTTCCAGCACGAGCTATCTGACCTCCTATCAATTTGTTCTAGACT
AACACATGCTACGGCTAGATCGGGCTCCGTCGCAGCAACAATATACTCACAGTTACGCCTCACAGACCATGACGGTTGCCAAAACCAACCAGGAAATTGT
CAGCCTCAACTGGGAGCAAGTGCTGCAGACTCCACGAGGTTTGATCGTCCCTGTGTGCGGCGCGTCTGTCGAGGAGTGAAATGAATTCGTGGAGAGTGAC
ATTCAGGGGCTGATGTCTGTGGATCGAAGGCAGAGTTTATATTGTGGAGCTGCCGTTAACCCAGCACGATTGATGTGTTGATGAGTTTAACTGCTTCATT
GTCCGCGAACCTGCAGTGCGGTCATACCTGAAAATGCATGGAATAACGTATCAATCAAATCGCTGCCTCACGGTGCCAAGATATCAAGCTGATGCAAATT
TTGGTCCAAGCCTGGCAGTAGGAGCACTTGCCTCGCAGGGATCCGAACTACGTGAGTTAGCGCACTCTCGTAGTGGCAATCGGGTATTTACGTCAGTGGG
GGCACCAGCGCGGACAATTGGACTGGAAGGCCCAACAATGGGCTCAAATTGCGGGTGCGCGCTTCATTCTCTGCGTCATGCTGTCTCTGTAGCTGAGTTC
AAATTGTACACAGTGACGCGGCAGGTCCACCAACTGCCCCACCAAGATTCTGTGCCTGTGATCGCTCCTCAAACGTTGGTTAAGTTTGACTCTCGCGTGC
TTTTAGGCTTACAGCAAGGTGACCCACAACCACATGACCACCTAGGAACTCTACAAGCGGCAGGAACAAGC