Description :
From Genome Similarity Track
Location :
scaffold_3:97416- 98449
Transcript NameFunction/comments
Plaha_PHALS_12671atp-binding cassette superfamily

Sequence
1033 bases(100 bases per row)
AGTCACACATGGACGACGGAGCTTTGCATAGAAGACTCGGATGGTGATGGACAAACGAATGGTGAGGAACTTGGTGATCCATGTTGTGAGTGGACATCAG
AGTCTGCAAAAGCTGCTCTTTGGTctagtggcgtctcaaatcCGGGAGATGCTGCAAGTACTTCTGACGAGACGTTATGGCCAACGTATAATTGCTCAAC
TTCTGCGACTAACTNNNNNNNNNNCGGGcttatgcccatggatctcagctatactgAGGACGAAgaaagcagagctccgagctgccaggCAGCATACAAA
TATACGACGatgtttgtctgtggagacacccgtcatctttagaacggttgccccatgcgcaaggcgcgtcaaggttcttcgaaccatcaccCCAATGCCt
gccagtctggtttgtcgtggGGAAACAATACCagccagtaggcgcgggcaACCTActagggaagaactgagttcttttAAGCCTCAGgtaggtagaggtc
aacagggcccagtccCGAAGTgccccgtgctcttgaacacggaacgtgtatgcaagccgggtttgctggtcgtggaggcgNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNaaagccatggaagatcgtCATC
GATTCCATGGCGTTGAGCGATAATGCTCCACACATCACGATgagaggaagtcagctgtatgctgaggcgctgaaagcgcggttgggtgacatcgtcactN
NNNNNNNNNATGCGCCAAAAATTCATGGCAAAGTGTCATAAGTGGGCGTACCATGGACTTTGAGGTCGATCTCGACACTATGCTCGAAGTGATTCCCCGA
AATACctatttccaagaaccacCAGTTGCTGGG