Description :
From Genome Similarity Track
Location :
Scaffold_56:97412- 98478
Transcript NameFunction/comments
g17907.t1hypothetical protein
g17908.t1hypothetical protein

Sequence
1066 bases(100 bases per row)
TTTACTTCAACACGAGCGCGCTGTCCTTCATCTTCGCGGGCGTCATGTCGCAGGCGCTGTCCTTCATCCTCTTCTGGACGCTCTCCTACGGACTCGTGCA
TATTTATTGACCGACCCAAGAGATGCCCAAGCTGCACTACACTCAAGGACACAAACAGATGCACAGAACATTGGAGACCACAGTGCAGAGAACTCGAGAT
ACTAAGGGACAGGAGCTGAAGTGCCGCAAGCTAGAGACCAAGTTGATACATTCCTACACGTTCTGCTTTGAGTCCTTCTTCATGCTGCTGTGTGGCTTGT
GGTTCAATGCAGTAAGAAGCAAGACGACAAGTTCCGATGTCTATATCTTGAGTCGACAGACAACAAACTCAGCACTTGATTTCCGTGTTTCTGGCCTATA
GTGTATGCTGGCGGCATTGCTGCAGCTAGGATAGTCCAAGGTGGCCGTCCTTATTTGCGCTGCGCCTGCTGGGCCTCCTGCATCTTCTGCTGCATGATCA
TGAGCACGGCCTCCAACATGTTGCGCTTGCCGTCGATCACTGTCTTGAGTTGCTCCGTGTTGCTCTGCAGAAACTCGACTTTTCGATCCATGAACTGCTC
GGCCTTGTCCACCGACTGCTCCACAAAGTATCCCGTGCCCACATCCACCAGTACCTCCGTCTTGTTAGACAGTTTACCAGGCACAAACATGGAGGCCGTG
AGGGGAACCAGGACCTCTTTGTCCAGGTCGGCGGCCGCCATAGCCTTGAGCGCCTCCTTGGATTCGGTGAACCGCGACTGGGCCTCGCGCAGACCGCCGA
ACGACGTAGTGAGCTGCTGCAGCTCCTTCTCCAGCTGACCCTTGAGTGAGTTGAGCTGCTCCAGCGACAGATCCACCAGGTTTACCTCGTTCTGGTCCGC
CATAGTCGACTTTGATGATTCGTTTGCGAAATGCTTGGACCACCAACGAACGCCACTCTAGTATCTTTCCGTTTCAGCCAATCCCAAGCGTTGAAACATA
TTTATAGCCTATCCAAAAGCGTGATTTCGATTTTCGTATATTGTTTTGACCAATCACAACGCGGAA