Description :
From Genome Similarity Track
Location :
Scaffold_2714:974- 2746
Sequence
1772 bases(100 bases per row)
TAGAAGTCAACCGAACCAATCCACGTCAGTTAAAGTGATAGCATCATATCGCAGCATAATAGGTTGTTTTACCCTTCAAGTACTCCGTCACGGGTACGAA
CCAAAGCGAGACGATACCAGTGCTTGTAGTCTCTTCACTGCCCACGAACGTGACTGATCCAGGTGTTGGAGGAGAAAATATCGTGGGGGGCAAGTCGTTC
ACTGAGGTCTGCACTTCGAAAATCTGCAGCGATATCCTAGCCGCAGCCTGGATCTGTGAGCATCGGGCAGAAAAGTCTGGTAAACTGGTCCCAACGAAGC
AAGTGCTTCAAAGTCGCCTACCTTGACAGTCTTGATTGCAGCTTCGGTATCCAAAGCCAGAGTAACCTTTGAAATCCTTTTCTGTAGGATTTCACTCGAC
AGCTCTGCAGTCTGCAGCACAACGTGTTCCTCACCGTACAAAGTTACATCGAGAGATTCAGTCGACGCAGTTGCTGAGCTCCGATCTGTAACGAGGTACA
AGTCGACAACTGACCGCGAACGAAACTCGGTTAGTGCTCACGTAAAAGGAGAAATGAGTCATTCTCGGCCCACCATTGCAGAGGTCCCACGTTCGGCCCA
GCACTCCATCCGCGCAGGGGTCGGAAGGGTCCACTGCACATTCAAACGAAGCGCTTGCGCTCGTCTGGGAGCAAGCTACTGTCGTGTTTGTAGCAGGCTG
AAGAGTGGGTTGGCAAGCGCAGCCTGACCGTGACAGAACCTGTACGGCTTGCACCAATGTGAACCAAGTGCACACGAGCGCAAGCAACATCACCGGCAGC
AGAGCCATTTTTTCGTGACTGTCCCTCCCGTGTGGCGTGTCAATGATCGGGGGATCTTCGTGACCCGCAAAACAATCAACGGTCCAAGTTAGAAAGCGCA
GAAGGCGTGTATTGAGTTAGCATATTTCGGCCGCGTGAAAGCGGCTTTGAAGGCGGGATGCATAGTTGGTAGACAAGTCTCCGTCAAGCAAAGCAGTCTT
ATTCCAGTGGTGGGAGCCATTAGCAAGACACAGCAAGCCTGCTGGACGCAAAGTGCCAGGAACTACTGACAAGCGTCTGGGATCCCAGCGCCCGGACGAC
TCCTAGCCAGACTGTCGCTTCCTAGTTATCTGCACCATCAGAGGCAGCCTCCACACTCTGAACGCTGCCATCCTCTGCACCCTCAATTCAAGAGAGAGTG
GCGGCTGTCTGGTGCCGAAACCTTGCCGACTCGAGGTCATGGCGCCTCTCACTGAGTGACGACCACAATGGCGACGGTCGAGTCGAAACCGGTCCCAAAT
ATCGTGTTTCACTTAAAGCAGCTTAAGCTTTCGTCAAAGCGTTCGTCCCATTCAGGCGTTTTACTAGTAGTAGTCCTACCGGTAGCTCGCCGCTCGCGAC
TGTTTTCTATCCTTCCAAAGTAGTTTTTGGCGTCGGTTGTTGCGTGGCGTACTGGCACGTTGAAGGCCAGCGCACCGGCCTCGAAGGCGTCATTGCCTAC
GGGTTCGATCCAGCGCCCTCGGCTCGAGTTGACGGGCGTCCAGCTTCCCCCGCTCGAAATCACCTCTCGGCCATGGTCGTCATGGGCTGTCTCGAACGAG
GGGCGAGGTGTTCGCCCGCATGAACACGAAACCTGCTCACGCAGCATTGGCGATGGATTTCGTCGGCAGATATTCATCTCACCACTTCCGGCCTCCTGCC
GGGTACGTCAGCCATAAAATAGAAGAGAAGCGGCTAGCCGTTCGCGCTAAATAGGGCTTTGCGTGGGGGCTG