Description :
From Genome Similarity Track
Location :
Scaffold_247:9735- 13642
Transcript NameFunction/comments
Physo_109668reverse transcriptase
Physo_144711hypothetical protein

Sequence
3907 bases(100 bases per row)
CNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGGTTCTTGGCCGCTGGCTCGGAAGCCAAGGCCGAGTGGCTCACGCCCC
GACAACGTGCAAGGCTGCACTGCTATGAGTGGGTTGACGGTTTGCTCCACTATAGGGCCGAGCCCGAGGATCCTCCCCGTATTGTCGTGCCCAACGACGA
GGATCTCAAGTACGACATCCTGATGGAGGCGCACGACGCTCCATCCAGTGGCCATCTCGGCCGTGAGAAGACGTACGCGTCTGTCTCGCAGATGTTTTGG
TGGCGTCACATGTACAAGTGGGTCGCCGCCTACGTCCGTACGTGCGAGACGTGCTAGCGCGTGAAGCCTGCCGGTCCCAGCGGACTGCTGGATGTCGATG
AGTCTCGACTTTGTCTTCGGACTTCCGGCCGATGACCGTGGCAACACTGGTGTTGTTGCCTTCGTGTGCCGTCTGAGCAAGATGGTCCACTTTGCTCCAG
TTCGTGACACCGTCACTGGCGACGAGGTCGCTCGCCTGTTCATGGACTGTGTCTTCCGACACCACGGTTTGCCCGAGACCATTGTCTCTGATCGAGACCC
GCGGTTCACCGCTACGTTCTGGCAGACGCTGTTTCGCCTTCTCGGCACACGACTGTCGATGTCGACGGCGGACCACCCGCAGACGGATGGCCAGACGGAG
CGCGTCAATCGCGTGCTCGAAGACACGCTCCGCAGTATCTGCGCGGAGATGCCCCGCTATTGAACGGGTTGCGCCACCCTCAGGTGCCGCTCACATTACG
AGGCAGTACCGGGGCTTCGGTCCTAAGTGGGGGAGAGGCTCGGAAAACCTTTTCCTCCCAAGTCTCGGACGTGAGTCCAGCCACCTTGCGGAAGCAACTG
TCCTCGTTTGCCGAAGACAGGCTGAACATAATCAGCAGGGTGCGAGACACCATGGCGCAAGCCCAAGATAAACAGAAGGAGTACTCTGACCGAAATGGAA
GAGGAAACATGAACGTGTTTAAGGTTGGGGATTTAGTTCTCCTAGATACTAGAAACCTACCGCTAAACACTGTTAGCTCGGTCGAGAGCAACAAGCTGAA
GCACCGCTTCATTGGACCCTTCACGGTCCTCAGCCGGCATGGCGCGGCGTACACCATAGACTTGCCCAAGTCGATGACGACTCACCCGACGTTTTACGGG
GGTCGTCTTAAGAGGTACCATGACCCTCTGGCTCTGGCTGCCCCGCAGGAAGCGGTGGGTGGTCCGGTGGAGAAGAGCGCAGCTCCTCGAAGCGCGGCGT
CGGGTCGCGGTAAGGCGCCTGATACGCGCGCTGGTCGTAAGACGGTGCGGCGTACATCGGAGCAGCATACGCAGGGGCCCCGTACGAGCCCTGGCCAAAC
TGGGCCTGATACGAGTGGGGCCGCTGCTGCTCCGGATACGGCGCGTGGCCATGAAGCTCGGCCCGAAGGCCAGCGAGCTGGTTTCGCAGCGAGTCGTAAG
ACGACAGGTCGGCTCGACGATCCACACGGCCGTGGAGACTGCGAGTTTCTTGATAGAGCGAGGCAACATTCTCACGGAGCCGCTCCACGGCACCAGGCTG
ACCAGCACGAGCGGCAGCCTCGCCATCAAGGCCGACGCCAAGCGCGATCTCGAGGACGTACACACGGTCCCGGAGAAGACGAATCTCCTCTTGCTGCAGG
GCCACCACCTGACTCGGGGCCCCAGCATACGGCTGCGTCGCCTCAGGCTCGTAGCCATGGCCGTGCGAGGCCACCGCCGGCCCTCCTTGATCGTAATGGG
CAGATCCACTACCACGTGGAACGAGTCGTCCGGGAGCGGCGGTTCCATGGCAAGCGCCAGCTGCTCGTGAAGTGAAGGGGTTACCCTGAGTCGGATAACT
CGTGGGAGCCCGTTGAGCAGCTCCAGGCAGACTGCCCGAAGGCTGTTGCGATATGGGGCGAGAAGCAGCGGCAGCTTCGTAAGTAGTCCTTGGCTTCTTG
GCCGGTACCCTGGGCACGGTAGCAGACGTAGTCGCACCACGCCCACGCTCTTCGCGAGCTTTGGCTATCGCCTCTTGCTTCAGCTCGTCCATCTTCGAGT
GGAGCTTGCGCTTGCTCACGAGTTGAGCGAACTCGATGCGGAGCTCGCGCACGTCCAGGATTGCGGACAGAGTGCGATCCTCACGGAGTTCTTTGAACTC
TTGGTCGGAATACCCTTTGCGCTGGACGTAGCGCCAGAAGAGGTCTTCCACCTCGCTCCAGGTCATGTTGTCATTCGGCTTGACCCAGTGGAAACCCCAC
ACAGGATGGAGTCCACCCTTGTCCTCCGGCTTCTTGCGAAGCGTGGTGAACTCCTTCAGTGTGAGCTTGTGTGGTGCTAGTAGCACACACCGGGCGACTT
CAACGTCGCCAAGAAAGAGTGGCTCTTTCTCAACAAGAGCACGCTCATAGGAACCCCTCGAGGTGTACCCGCCGATAAGGCCACGAGGAGCCGAGAGCTT
CTCCAACAGCGCTGGCGCACCAGTGCCAGGCTCGGGCGGGAAATAGCCCTGCGGGTACGTGGCATCCCCGCCTGAAGAAGACTCGATGGTAGTCGTGGCA
GTCGGCTGCCTGGCATACGCACCCGAGCTAGCAGCGTGGTATTGCTGCTGCTGCTCGTCGAGGTTGTTGGAGAGCTCCTTGGGCTCGTGGACGGCACCCT
CCTCGTCCTCAGACTCCGAGTCGATGAACAGCTTGGAGCTGGAGCCGCGAGGCGACCTGGAAGCTGAACGCTTCTTCGCCTTGGCCTCGGCGGCCTTCGC
AGCGGCAGCCGCTTTCGACGCTTGGGCACGCTCACGACCTTGCGCCAGCGTCAGATGCTTGGATACCAGCACCTTCTTGGGCTTGGAGCCCGCGTCGCTC
GGCGACTTCTCGGCCACGACCCCAGCGTCGGCCATGGCGACTTCGTCGTGCGACTGCTTGCTGTCGCCTGAGCCGGACTCGGCGTCCTCCGCCTCCTTCT
CTGACGAGGCCTTTGCGTCGGCCGAGGCGTTGGTCATGTCGCCTGCCGCCAGCTCCGTGCCTTCGGCAGCGTGCGTGCTGCCCTCCGAGACGTTCTCGTC
GTGGGGTGAACTCTCACCGGAGTACTGGACCATCGTGCAGTCAAAGACGGCGGCTTCCCAGTCGCGAGCCGGGCTTTTATGGCCCCGAGGACTCTCCTCC
TTGCCTTGCGCGGCGTCAGGAGACTTGCTCCGAGCCCCGGCCTGACGGCCACTCTCCGGTGTGCTGCTACGAGAGCGCACCACCTCCTCGGCCGCCTTCG
TAGCCTCCATCAGCGCGGATGACTCGTCCTTGGCCTTGGCCGCCCTGGTCTTCGGCCCTACGGCCCGCGGTTTCGAAGGTAATTTCGCACTGCGCGCACT
GCGCTTTGGAGGCATGCTTCCGGTCGACGTGGAGGCCCTGCGGCTTGCTCGGCGATGCGCCAGTTGCTCTGTGAGGCCCGGGAGCCGAGGCGCCAGAGCT
CGCGCCGTTGTCGATGGATTTCGACTTTGCGAGTGAAATGTGAGTCGCCGGCGTAACCTCGCTCTGATTGGTCGATAAGATCGAATCTAAGTGGGTGAGG
ATGTAACGGGGTTACATGGAATAGTGACCCTGTCACTATTCAGGGATGGCTACATCGGTCACTCCCTGGATAGTGACCCAAGTGGCCACAGAGCCAACAG
ATACATTTTGTATGACACAAACTATAGGGAACTTAGGATTTGTATGCAGGCCAAATCTGTACCAACCTATAAATACATTCAGTCTTAGATCTACCGCTTT
TCAAGTCAAGTCGTCCCCTGCAGACCAGGGACACGTGAACGACTGTTCACTTGGAGTTTGTATACTCCTGCTTCCTCTGTTAAGAAGTGCTGTGTGCCCC
GTCACAT