Description :
From Genome Similarity Track
Location :
Scaffold_28:9733- 13150
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_28-fgenesh-gene-0.7HECT ubiquitin ligase

Sequence
3417 bases(100 bases per row)
CTCGTAGACGCCTCTGAGGAACGCATAAAGCTGGTCCTTGACGCTGTCAACCAGTGCGTACTTGAGCTTGGCGTCCACATACTCGCGTTTATTGGCGTCC
GTGACGTCGATCTCACTCCCACCAGGCACCAACTCGACGACCTTGATTGTGCCGTTTGGGAGCTTCTCGACGACCGTAAAGTCGAGACCCAGCATATCGA
CGCCATCATTTGCCAGGAGCCACTGGAGGTTCTTGAACGCATCGGGGTCGAATGACTCGAGGTCTTGGAAGCTCACGGGAATCCCCACCATGATCTTGAG
CAACGGCAGCGCCAAGTGGAAGCCCGTGACATTCCCCTCTAATAGTGCGCGGCCTACGAGACGCCCGGCCGCCAAGAAATGCGCCAAATGGTGCTCGCCT
AGGACCTGTCTCGAGTGCGGGTTGAGGTAGAACGTCTGATTGTGCTCGTCGACGCAGTGGAAGATGCCGGCCTCGGGTTTCACGATCGCTTCGTTGAGGA
GGAGGAACCACTCGCGGTAGACGCCGCCAGCATCGATGCCTTGTTCCTCGACAAAGTCGACGCGGATTGCAGCGCGCGCCTGTTGCGGACTGAGCGTCGC
AATGGCGGTGATGGATTCCATGAGCAGCTGGTCGCGTTGGATCGCAAACCGAGAGATCACACGCTCGTGGGTCTCCTGGGACCGGGTGGTTTCGTTGAAC
ACACTGGCCATCGACATGATGAACTGCGCGAGCTTGGTGGGAAACGGCAGCTGCGCGTTCTGCACCGTGTCGGCGATCGCCTGCACGGCCTGTGGGGNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAGTGTGCTCTG
CTTGGGCTTGCTCTGAAGGTGGCGTAGCTCGTGGTGTGTTGGTAGTGTGTGCGGGTTGACTTGGAGNNNNNNNNNNTCGAAAATGCGACGCATGACGCGT
CAGCGTCGCTGGTTGCAACGATCTCCACCTCTAATGCCTCCAGGTCATTCTGGAGGAGCTGCGTGACGTCGACGATCGTTACCTCGGGCTCTGGGGGAGC
TTCCGGTTCATCTGGATTTCCAGGCTCTTCAGGATCTTCCGTGTCCACTGTGATAGTAGTGTGCTCTGCTTGGGCTTGTTCTGAAGGTAGCGTAGCTCTT
GGTGTGTTGGTTGTGTGTGCGGGTTGACTTGGAGGCAGCGGCTGGTGCTGCTGAGGGAGCGGAACAGGCAGTGCTGGTTCTATTATACTGACGGCATCCT
CTTCTTCCTTGTCAAGGACGGGGGACCGCACGGCTCGCAGTACGTAGGCGGGGTATCCAGCGAAGGCTGCGTCCTGTAAGGTCGTGTCCTGGACCCACAC
CACGCGTCCGCGCTCATCGACTCGTCGCGCCCACTCCTTCCTGCGCCTATATTAGTAATAATTCCATGAAGCATGTCAGAACCTCATGCAACTGTGACGA
TGGGGGGCGAGGGTCTCGTACCTCACGCGCTGTTGGTGGTCCGTGAGCACCACCACGTCTTCTTCTCCTAGCGCTTTCTTCTTGCGCCTGAAGAGCCCTT
TGGGTTTGGGCGGCAGTGTCGCCCCACACAACACGCATGCGGCGGCACGCACCGAATTGGCGAAGCCGCAGCGGCGGCACTCGGTGGCGCCCTGCTTGGC
CTCTCGGAGTGCGAGAGCGACGCGCCGGTCGAACGCGTTCCGCGCGCCGCGCACGGTCGGGCTGCGCAGCGCCTCGTAAACGTGGTCGTTCTTGCGGTCC
CACTTGGTACAAAACTTGCGCACACACAGCAGCAGGAACGGCATGAGCCCAAAGATGACGTACAGGACGTCCACCACCGTGCTGCGCCCGCTGCCGTCGT
CGGTCGCCATCCTTAGATGTGGAGGAGCCCGACGTACTAAGAGTGATCTCTGCACTCGGCCTTGGAAGCCATCACGGCTTGGCAGCTACGACCTGTGATA
TCCGATATGCAACCTACTGATGCCCAGCTGTTCTAGGTCATTTCGATACAATCGCCACCTCTTACAATGAATAGTTCGCTGCTCGCACATCACCATTTCC
CTGGCCCGAAATATTCCCGGTGCGTCGTTCCCCATGTTGAGTGGATGCTGCTTCTTGGACACATCATCAGACCGCCGTGAAGCCAAACGAGTCGACGGCG
ATGGCAGCAGCGACCGCGCGGCGCATGGTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAGGTCGAAATGGAGCGGCAGGTCCAACCGGTTGAAACACG
CGTGGCTCCTCAGGTATCCGCGCGACCGCCACACGGCCACGCCGTGAAGCGTGAACGCACACTGGCGGCCGTCGTAACTCGTGAGAGCACTGAAACCCCC
AGGGGGAACCCGTGTCGCGCCGGTCGAGAACTGGAGCAGCCGTCGACGCTCCTCCAGCGTGAGCTCGCGGACGACGCGCCAGAAATTGGGCAGCGCCGGG
TGGAGTAGTAGATTGCCAGACGACTGCGAGCTGCGTTCCCAGTCGTCGACGNNNNNNNNNNTGATGTCGTCCGAACCGGCGACCAAGTGGTCGAGCTCTT
CAGCGTCCAGCAGCGCGAGAAGAGTGGGCGGCACGACGTCGTAGAGACCCTTGAGAAAGGCGAAGAGCTGCGGCTGGACACGCGTGAACAAAAGGTACTG
GAGCTTGCGGTCCACAAAGTCGCGTTTGTTGCCTTGGTGACGTCGAGGGCGTGGCCGTTGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNGGTGAAATCCAGGCCGAGCGACTCTGCATCGTCGGTCTCGAGCAGCCACTGGNNNNNNNNNNAGATTGGAGAAAAG
CTCCGGGTCGTAATACTCGAGGTCGGGGAAGCCCACGGGCACACCCAAGATGATCTTGAGCAAGGGTAGGGCCAGGTGGAGGCCCGTGACGTTTCCTTCG
AATAGTGCGCGACCGATCAGTCTCCCCACCGCCAGGAAGTAGGCCAAATGGTCGTCGCCAAGACTTTCGCGGGAGTGGGGGTTCAGGTAGTACACTTGGT
GTTGCGGATCCACACACGTGAAGACGCCAGCCTCGGGCGCGAGGATCCGCTCGTTCAGCAGAACTAACCACTCGCGAGAGATACCGCCAGCGTCGACCCC
TTGCTCGCCAGCAAATTCCACCCGCACGACCGCACGCGCATGGTCGCGCGTCAGTGTCGCGAGCGCGTCGACGGAAGTTGCCACGAGCTCGTCGCGGCGA
ATGCTCAGCCGCGTCAA