Description :
From Genome Similarity Track
Location :
Scaffold_57:97328- 103967
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G014002Protein of unknown function
Pytul_DAOMBR144PYU1_G014001Similar to ASPM: Abnormal spindle-like microcephaly-associated protein (Homo sapiens)

Sequence
6639 bases(100 bases per row)
GTCGACCATGTGTTCACCTTCGACAGCCACTTCAGCCCTGACAAGCCGTTCACGATTCAAGTGAAAAGCGGCGAATCCGTGCTACTGCCTCTGGATCCGA
TCCGTGATCTGTTATATCCCTCTACTGAGGCATTGAACCAAGACCCTGCCGCTGCAGCTGCTGCTGTATCGCGCTTTGCACTTGGTCTGGAGCTCAGCAA
CTGCCGCGGCAAGCTCCAATCGTTTATCCAGTTCAAGAGCAAGCGCACAAAGCGTTTTTCCACCGCGAGCTACCAGTGCATGACAATCAGCAACGCAAAT
GAAGAAGAGCAGCAAAGCGTCAACCTGTGTCCGCAGTACGACCCGTCTCACCCGATCGCGCTGCGCTACGATCCATTCGAGATCGACGGCTTCATCCTTC
GCGCAGACATCGGTGAGCCCGTGGAGAGTATCGCTCTACTTCGGTCGACAAAGTCCTTTGGAGGCTTTGAAAAGGCCTTTCTCGTCGACACTGACGCGGA
AGATGATTTAACACCGACGCCATTCAATGTGAGCTTCTCGTACAGGAAGACAACGCTCGGGTTCGCCTCCCCATCGATATGGGAACATCCAGCAGAACCA
TCGAGTCTCTCAAAGGAACAGGTCTGCGAAGCGTGCGAGTACTTTCTGTTCGCAGAGAAACTCGAGCCTAATGCAACGGTCAGCAAGCAAGACACGCTTC
CCTACTGCATTCAGCGGCGCTCGAGCGTCCAGTACCAGGTGCCGACGAAGAGTTTCACGAACGCTCTGCTTGGGGTCTCGACCGACAAGCACGCGAATTT
GGACGATCTCTTTGCCGACCAGTTCAAGTCCAGTGGCGAGTATCGCTTTGTGCTGATGGCATCTTTGCCGAGATCCACAAACCATCGACACCCTGCGATG
CTTGCGTACGCACCTCAGCAACTGTCTGTCGCAGGTACGTGGCATTCTTACAAACGTTTTGTGTATTGTTGGTTCACATTCGACTTTCATGCTGATGGTA
TTTGTTGCATGTTGCATTCATCACAGTGCCTCCATTTTATCAATGTAAGTGGTGTTTGCTTACATTGTGAACCCCCAAGACTGGAAACAGGAGAATGGCT
GGCACTCACACAATTCGTTCCGTGCATCAACTTGTTTTGTAGCTCATTTCTTCATCGCGTTTGTTATCGTGGGCGTCGTGGCGCTGGCTGCCATTTTTGC
TGTGCAGTATCATCCACACCTCCGCTTTTTCCAGAGAAAGCCCAAGGCCAAGGCATCCGCTGAGGATGCTGAGGATGAAGCCGAATTCATGCGGCTCTTG
GCTGACTCGACTGCGGCATCTATTGACACGATGGATTCACTGGAGGAGGGTCTTCTTCCAAGTGAAGAGTTGCGGGAGTACGACGACGACGATGCGGCTG
GCGACACTTCCGGGCGAAACTCTCTTCTGGCAGCCATCAAGCGAACGAAAGAGCAACAACAGCCTCAGCTGGATGGATATCACGAAATCAACTAGCGTGT
GTGCGCTTGGGGGCTCCGTTGGGCTCGTCGGTGAACGGCGTCGATCGCCACTGCTACTAGTCTTTGATTGTTCTTGTCTATGTTTGCATAATAGCCTCGT
TTTGCTGTTGGGACGCGTTGAATACGAGTAATTGAAGCGTTTCTTCCTTCAATTGCAGGAGCTGCTGCAACTTGTTCGCTGCGTCCTTGTACTGATCACT
TGCCAGCAACGGTGCCAGCTCGCCGGCAATATAAAGTTGGATATCGTTTGCTAGGTTCAGAAACGTTTTCGCATGCGCTTCGTATCCATCTGGTTCATAG
AGATCTATCCATTGCCACGTGCGTACAATGAACCAACACTCCCGTGTCGAATGAGGAGCTATCGAGCATGCAGCGGCGAATTTTGCGGCCTTTTTGCCGC
CAAATTGGTCATGCAGCATGATTCGTTCGTGCCAAAATCGAGCACACGCCAAGGCGTCCGCTTCGTCTTCAAGTGTTGTTTTGCTGTTAGCTGCGTTACT
TTCCTCCTTGTCGTTGACGGATTTCGGTGCCGCTTTAAACGGAAGACCTCTCTTCGTTGTCGTAAACACGACAGCAGCGCGGCGCACGGCGAGTTTCGTC
TTGTTCTTCGAGTGGAACGGATGCAGCAAATCGAGCAGTTTGCTTTTCGCGATCGCGACGCGCTGCTCCACTTCTTGCCGCTGCTCGATCTCCATCCGCT
CAATGAGCTCCATGGCTCTTGGGACTTCAAACGTTCGCTTGTTCAGCACGACGTTCCAAAACTCCTCTTTCTTTTCGTGTTTGTTGTATTCCACGACCCA
CGCATACCGCACGATATCGTGGAACTCGATCGTCTGCAAGTACAAAAGACGCGCTTTGCGTGTTGCCGTACTGACCACTTGCGCGAGTTTTGTGTGGAAA
TCGCTAGCAGCATTGAGCAAAGTCTGCGTCGCTGGCTCGTACGGTTGACGCAATATCTCATCATCATCGTACGGTGCAATGTGTTCCCAGTTCATGACAA
CGGAGCAGTTCGCAAGAGGAAGAAACACGACCACAAAGCCCGTGTGCAGCAGATTCTGAGTCGATAGAATCGAACCGACGCAGTTTTCCCACTCTCCCCT
CAATATCTTGACACGAACATCGTACACACACCACGAGCGTGCAGCTTTGAGCACAAGGGCCTTGTGCTTCTTGGTCCAGCGCTTTTTCTTCCGCGTCGTG
ACGACTCCATTTGCGTCGATAGTCGTGACGCGACGGTGGAAAAACAGTGTTTGCTTGATCATCTCCAAACGGTGTTGACGAGCTGCGATTTCTTGCTTTG
TATCCGAATTCAGAGTTGGCGCTATCCCAAACACGTTCTTCATCTTGTACAGAATAGAAGCGCGAATTCGTTCGTCTTTCAGCCGCTGTGCCTTTGCCGC
TTTCGTCTGGCGTACCAGTTTCATGTACGCTTTCCCTTGCTTCCGTTCAAGGAACGAGCGAACGAGCGCCTGAATGATGGTAGCGCTTTCGTTGCGATGT
TTCAAGTCGAGTTCGCGTCGCTTTCGCTCTTCTTCGCGCTGCTTCAGTCGCGTTTCCAGCTCTTTCTGCTCCTTCAACGCGCGATCTTTCTCTGCCTGTT
CTCGAAGGACAGAGAAATAGCTGACGCGGTGGCATTGATGGTGCTGCCGCTGACCCTTTGCATGCAACGAGCTCAGGCAGCGTTTGCAGTAGACATCCTC
ACACGTCTCGCACTTCCATTGCGCGACGCGCGCAGAGCACTCTATACACATGACCACAAGCGACTGGAATCGATGCGTATCCAGAGGCTTCGCAGGTATC
ACCACGATACCTTTCGCCTCAGCTTCGCTTGCTAGGCTGCTTTTGAGCCTGCTGCTGCGTCGAGAGCTGCTACTCGGCGGCTTGTGAACATACGGGAAGC
ACGCATCACAGAACGGAACGTGGCCATTCCCGCAGTGCAAGCACTTGCGCGTGGCTGTCTCCGTACGGCAGTGGCTGCAAAGTGCAATGTCGCGGGTTTC
GTGGACCTGGAACGCTTGTCGCTTGCTGTGGTCGCGAGCGAAACAGATTGCACACATCACGTCTTCGCATTGCATACAATACACCTCGGCAGGCACCTTG
CCAATCAAGTTCGTACTGTCTTCATGGCGCTCGCAAAACGCGTGAAACTCTTCGCCAGGGAACGGCAGCGGGATGATATTCTTGCACTCGACGCCCTTGA
GAAAAATCGGCCGCTTGACGATAACTTTACCCGTTGCAATGTGTTTATACCTTGCGGTGCACCCAGTGTGGTCTATGTACTCGGCAAACATGCTCGCGAG
CATCATCTTCATTTGCACACAGAAGCGATAGCGCCGATAGCCTTTCTGAATGCTACTCGCACAGCGAATGTTGCGACGCAGCTGGACGCGCTCTTTGTAG
ACGATGAGAAAATGGTCGTGGCATTTTTTCGCTGCAAGGCGTGTCGCGAACCGACGAAGTATTGTCACGGCCCATAGGATGCGTTGCGTGCAGTGGTCCT
CGAGAGTTTTACGGAATTTGCCGTTCTGGATCGTCGACGGAAGCACGAACTGGTGCATGAACTTCAGATACCGCACATAGTCTTCGGGCTGCGCATTCGA
CGAAGCCACCACTGAAGAGTGCGTTGTCGACTCTAATGTTGCACTATCAGCTTTCTTTTTATCGGGCGAGGTCGGCGCAAATTTTTCTTGCCAGATCATG
GCCATCGCCTTGTTGAAGCGCGCGAACGAAATGGTCCGCGCTTTTGGTTCTTTCATTTTGGCAAAGATCAGATCAACTGTTTGCGTGGGGAAGCTCGTCT
TGTTGATAAACGAATGCGGGAGCGCTTTTAGGAAATGCGCAAAGCGCGAATTGTCGATCTCCGCTGACCCACCTGACGCAGACCGAAACACATCTTGCCA
GACACCATCATAGCCTCTCCGTTTCCAAAGCGATTTGCTTAGATCGGCGCGATATAACAACGTATCCACGCGCCTGATATCAGTTTTTCCTAGCGTCTCA
CTTTCGTCGGCGATAGCAAGGTTCTTGTTGATGAAGCTCTGCAAAAGTAGTTCGTCCTTCACGCGCCGGCGAGTTGCCTCCATCAACACCTTCCCCACTG
CTTCTTGCTCTGCCAGGAATTGCTGACGGCGAACCATTTTCCGAAGCCAGCGTTTGCCTAAAAACATGCGAGCCAGGCCCTGGATACGCCGTACCGCACG
CACGCGCAGCCGTTGGGTTTCTTTGTTGCGTCTTTGTTTCCATCGGATTTGCATCTTGTGGATCGCTTGGTGTGCTTTGTGCAGTCGGACAAGCTCTCGG
CGTGTTCGAAACCCTCGCCACGCACACTGGATGCGTCTCGCACCTACATGCACCATCCACTCCCACGCTTTGGCTCTGCCCTGGATACCTCGAATGCGTT
TTTGGATGCAGATCGCTGCGTGCTTTCGAGTCTTGTTGAGAGCACGACACTGAAGCTCACATTCGCGTGCCTCTTCATAGCATAGCCGTCGACGAAGCCT
GATGCCTCTCCATCGTGCCTGTAGCTTCGTCGCGGCCTGTACTTCGCGTGGACTTGGACTGGAATTGTGGCCGCCGCTACTGCTTTGCGTGACGACTTTG
TCTTTTATTGCCACGACCTGGTTCCATTTCTTTTTCATTTCTTGAGGCACCAGGTGATGAGCTGCGTGCTTTTTTCTGCGCTCTTTGATCTCCGTGATCC
ATTGCTGTCGCTGTTTGTCACGTTCTCTCTCGAGCGCCGAGCGAATCTGTCGTGCTCGATAGCATCGCCATGCACGTTGTAGCACGGGAACAGCGTGAAA
TACCTCCAGTAAATGCCGGATATAAAACTTTCGAGCTTTTCGGCCACGGAAATGGGACTGCACTTTCAGAGTTTTCAGCTTGTCCTTCTCAAATTGAGCG
CGTCGCCGTCGAAGTGATAAAATACGTCGTCGATGCCACTTGCGGAACGCTCTTTGGATCATAATTACTGCTCCGTGGATCTTCATCTCACGCTTTCGCT
CTCGCGTTTGCCGCTCCAAGCGCTGTTTCTTCAGCTCCACGCGCCGGATTTTCTCAAAAATCCGCTTTTTCACCCTTGCTTGGTGCCCACGAACGTGTTT
TTGAATGCACACGGCGGCATCGAGACGGTGCTTCTTGCGCAGCTGAATTCGAAGCGCGACCCAAAGCGCCTGCCGCTCTCGCCAGAATTCCTGGATCACC
CGCGCTGCCTTCATGCGTATTTTGTGACGCCGTCGCTGGTTTTGATGCGCGAATCGTCGAATCGTATCCGTAATGATGCTCGCGCTTTTGTGCTGCTTGC
TTGCGAGTATTCGCAGCAAAGCTTGCTGCCGTTTAAGAAGCTCACTTCGTATCTGTCGGCGGGTGAGTAGCTCTCGCACAGCCAAGAGCTGGCGCCACCA
ACACTGAATCCGTAGTGAAGCTGCCGACATAGCGTGAAACCTCGCCGCGGCGACGACTTGTTTCCATTGCTGCACAGCCTGAATGAGCAAATTCAACTTG
AGGCGAGAGCCCACAGTAAAGAGTACTTGTGTTGCGCGCTGTTGCGCTGGAGACGCGAATTTTCCCATCCCGAACGCGTAAATGACATCCAGTGGTAGAA
AATGCTGGATTTCTGTCAGGGTCTGCTCTACTTTGATGTTTGCATCGCGCTCATGTTCCAAAGCCCTCTCTTTTTCCTGCACTAGGTGCTGGTAGTTTCG
AGATGGAAAGCTTGTTCTTGAAGTTGTGTCTTTGAGAACTGGCGACTCTCTAGGAACGACTATGTCGAGGTTGGCAACGTTTACATCCTCCATAGCCATG
CAAATTTGCTCGTCGCGCGTACCCCATTTGTGCTGCGGCACTTTTTGAGACGGTTTCCTGCTCACTTCTTGGCGTCGAGCCATCGGAACTTTTCGATATG
CAGGCAGCTCATCAAGTGAACGCCTATTTCTCTGCAGCACTCGCGTTGCAGGGTTTCTTAGCTCTCTTCTCTGGCGAAGGACCTGCTGTCGCTTCAGATT
CTGATACAAGCTCTCACTATCACACTCAGCAAAAAACTCCAGCTCATCGATCTCTTTCACATCGTGTTCGCTTGGTGGAGGCAGTCGTGCAAGTCCTTGG
CGAGTTCGTGGCGACATCGTAGTTAGGATTGGAAGCACA