Description :
From Genome Similarity Track
Location :
Scaffold_1180:973- 4901
Sequence
3928 bases(100 bases per row)
AGTAGGCGCGGGCGCCCTACTGGTAATGCAGTTCCGCGTGTCGACCTTGGACACGCGACACTGAGGCCTGCAGTCCCCAGTGAGATTCATTCTCACCGCA
AGAACAAAGATGACAAGTCTGACCTTGTCATCCTGAATGTGAACTCGATGAGAGCAAGCGGCTCTCTTTGCGCTTTGGTAGATTCTGGTGCGTCGAAGAA
CTTTATTCGACTGCAAAGTCTATCAAGGCTTGACTTCGAGGATTTAAAGATACCTCGAAGTATGTTGAAGGTACGACTGGCGACGGTCGCCGTCGTGAAG
ACCGAGAAGCGCATGGTACACGAGCGCTTCACGTATGAAGATCAAGAGTTTGTCGAAACCTTTATCGTCTTGGATCTGGACGATAAGTTTGACATTGTAT
TGGGCATGCCGTGGCTTGCACGGCATGATCCGGTCATCGATTGGGAGAAGCGCACTCTCGTGCGCTTCGGTCGCTACTGCGAAACAGTGAGGGATGACTC
TGTTTTCGCCACACACGCACCAACAGGTGCACGCGACCCCCCCCACTCGAGACAGCGCCTAATGCCGCTGTCCCGGAGCGCCCTGTGCGCGCGCGAGCAC
GCGCGCAAGAGCAGCTAGTGTCGGCGTTGCCGCCGACAGCAAATGACGGAAACGTGTTGACATCGGAGGCCGACACCCGCTTTTCAGCGAATCAGGAAGA
GTCTCCGGCCTCAAGGGGCACGGCTGACGCAGGCGAGTCACACGCCTCAGCCGTGGAGGCTGACGCGAATCTGATTGGATCAGTTTTGCCCATTAATATG
AGCCAAGGTGACGTAACGCCGTCGACTCCGGGAGTCGATGGCTTGAGTGAATTTGATTCGTCGGCTCAGGGAGCCGACGCACCCTCCGTAATGGAGGTCT
CCGCCAATGGATGGCGTCGAGGTATTAAAGTCGCGACGGTTCCGGGAACCGACGCTGCGAAAAGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTCAAGAAGCCACAGGGCAGCTGGCGCATCGTTCATGCGTACAACAAGT
TGAACGATGCGACGATACCGGCGCAGACACCAATACCGCGAAAATATGTCATCATCGATTCGATGGCCAGGAGCACTATCTACAGTGCTCTTGATCTGCG
CGATGGGTTCTATCAGATCCTCATGCGTGAGAGCGACATCCCTCCCACGGTTGTGAGCACGCCGATCGGCATGCTCTTGGAGTGGCTAGTGATGCCGCAG
GGTCTGAAGAACGCCTCTGCGACCTTCAACAGGTGCATGACGCACTTGTTGAGCTCGGTGCGCGACTTCGCACCGAGCTACTTCGATGATGTGTTTGTCC
ACAGCCGGGCTGCGGACGGGATGAGCGATGTTGAGATGCACAAGGTGCATCTCCGGAAGCTGCTTGCGCTCATGCGCAAGTACAAGCTCTATGCGAACCT
GAAGAAGTGCATCTTCGGGGCGAGCGAGATACACGTGCTCGCGTGTCTCGTTGGGAAGAACGGTGTCCGCCCTGACACTGAGAAGGTCAGAGTGATCAAT
GAGTGGCTGACGCCGTCGAACGTCAAGGAACTGCGGCAGTTCCTTGGCTTGACCACGTACTTGTGCAAGTATGTGAAGGACTATGCGGGCACGATTTGCC
CGCTGTCACAGCTCCTGAAGAAGGAAGCCGAGTGGCATTGGGCTGCTGAGGGTCAGCAGGCCTTCGATGCAGTCAAGTAGGGCTTGACTGAGGCGCTGAT
CTTGGCGGTGGCCGACCAAGATCGCCCGTTCCACGTTGTGTGCGACGCATCCGACTTCGCAATCGGATGTGCGTTGATGCAGCACGATCACGACCCTCGT
GATCGTGTCGGCTACTACCAATCGCGTCAGCTGAATCCAGCTGAGCGCAACTACCCGGTGTATGACAAGGAACTCCTTGCCATGAAGTACGCACTCGCGA
AGTTCCGAGTGTATCTACTCGGAAAGAAACCGTTCGTAGTCTATACGGACCACGCGTCACTGCGAACGGCTGTGAAGTCACCGCACATCTCGCAACGGAT
GGTCAGATGGCTCTCATTCTTCGCAGAGTATAACTTCCGGGGTTGAGTACCAACCCGGAAGACTCAATGGGGTGGCCGACGCGCTATCGCGTCGACCTGA
CTACGCCACGACTGATGCCGACGTCAATGCCATTGACGCCATGCGATCGAGCACCCCAACGTCGTCACTGTTGGACGACGTGAAGGTCGCGTCCGCGCAC
GACGCGGACGCGAAGTTCTTGCTGGCCCGTCAGAAGCTGCCGAAGCATCTTCGTGCTCGTGCATACCGATATCGGGTGTACGACGGGTTATTACTCTACA
GTGCAGACGACGACAGCGCGGACTTCGTTGTCGTGACCAATGACCATAACCTGCGACTCAGGCTCATGTATGAGTATCACGATACCGAGTGCGGGGCATC
CGGGCCGTGAGAAGACATATCTTCTTCTCACGCGGGACTTCTACTGGGCCCACCAGTATAAATGGGTGCGCAAGTACGTCCGTGCTTGCGAGGTTTGTCA
ACATGTGAAGCCTGTGCCTTTCGCGCAGGCTCCCTTGCAGACACTGCCGACTCCGTCGGAGTGTTGGTAGTCCATATCTTTGGACTTCGTGTTCGGTCTT
CCCCCGGGCAGCCAGGGGAACACGGGCGTTGTGGTCTTTGTTGACCGCTTCAGCAAGATGGTACATCTTGCTGCAGTACCTGCTGAAGTGACTGCGAAGC
AGACGGCGCGTCTGTTCGTTGACATGGTGTTCAAACACCATGGTATGCTGATCGACATTGTGTCGGATCGAGACCCGCGCTTCACTGCACACCTTTGGCA
AGGAGTGTTCACACTTCTTGGGAGTCAACTTTCGATGTCGGCTGCGGACCATCCGCAGACGGACGGGCAGACCGAGCGCGGGAACCGCGTACTCGTAGAC
GCGCTAAAGAGCTACGCTCACTCGTTCC