Description :
From Genome Similarity Track
Location :
Scaffold_2926:973- 2570
Transcript NameFunction/comments
Phyta_totarag14940hypothetical protein

Sequence
1597 bases(100 bases per row)
GATGGCTTGGTGTAGCGTCTCTGGTGCAACCAGCCTCATCAATCCGTCGCGATCGGCTTCGGATCTCTTGGTAGGCGGGCAGTAGAACAACCGATCATGG
CCATCCACCTCATAGTCAGCCGCAATATTGCCGAGAGATCTAGCTTCGTCTTGCGTCAGGTTCACCACATCTCCTGCCAAGTACTTCTTCATACTCGAGA
TCCACGCTTCCTCATCCAGTGCCTTTCGGATCCGATCGATCTGCAGCCCACGGGCAAATTCTTCTTGCATGACCGTTGGGTTTGATCTGGATCGAGCACA
GGACCGAGTAGCCACTGGCGAGATCCGGACGACTGGATCATTGGATCCGACTACCAGAATCTCGTCGAGTCAATTCAACGTAATCAGGTCTTGGCGATCC
GCTTCACTCTTAATGTCGATCCCTCCCAGACGTTGGAGAACTGCGCTTGCCAGGCTATCCACGCTACCATTCCAGTCAAGTTTAACATGTAGTAGCTCGT
GATCTGGCCAGATCCGCAGCAGATCTAAAGCCTTCTGCTTTAATAATGTCAGCCCGGGTGCCTTGCAGTCGATCTCTCCTCTCACTTGCCGAATCACTAG
ATNACTTCACGATCTCGAGGGTCCAAGGTGACAGGAGAGCTGCCCACTGACCTAGTCGATCCTGGAGGCCCGGCGACCTGAATAGCCATGCCAGAGTTGA
GTGCCGAGTAAGGATCTGGATCTGGCGCCCCACTAGCATATTGTAGTTGAGATCTAGGATCCGCAGTAACGCTAacacttccttctccaccacattGTAG
TTCAACTCGTTTGACTTGAGCGTCCGACTGGCGAAGGTGACAGGACAGTAAATCTGGTCGTGCTCCTGCATCAGAGCAGCCGACATCGCCCAGTCACTGA
GATACACGATCACCACTGGTAGTCGATCTGGATCGAAGTGGCGCAGAGTCGGTGTCGTCGCAACATTGTGAAAGACTTGTGAACTCGGAATCACCGTTCA
TCCGCGACGTCCAGGTCTGTTTGGCCTGGATCCAACGCCCCTAGTCCTGACGAGGCCGTATCGGATGACCCCTGATCTAGTTTCCTCAAAATCTGACGCA
GATCAGGACGTGTTCTCACCTCAGCGAAGCCCATCTCACGCAACTCGTATAGGATCGCCGCGTAGATCGTGTAGTCTTCTATGAAGTGGCCGTAATAATT
TAAGCTGCCCAGAAAAGACTGCATCGATCTGAGTGATCCTGGGAAAGGCAGGTCCGTTAATGCTGACAGATCCTTGGGGTTGGCCTCCAGACCATCATTT
GACACCCGATGTCCTAGATAGTCCACCTTGCGTAACCCTCAGAAGCTCTTCGCCACGCTGATCGACAGGTTCCACTTATCACACGTTTCCAGTAGATCTT
CCACCCGATTGCATAGCTGATCCCAGGATCCGGCTGTCACGaggatgtcgtcgatgtagGATCTGCGTCCCAACACCGATGGGCGTCCTGGATCCTCCGG
TTCCCCAGCCTCAAACAGATCTACGATGCCTTTAGGATTCCCTGATCGCAGGATCCGCATAAATCCATACAGTGCGTTATCCAGGAGCCGGTGGTAG