Description :
From Genome Similarity Track
Location :
Scaffold_173:973- 2275
Transcript NameFunction/comments
Aphas_H257_18515PREDICTED: polyproteinlike putative

Sequence
1302 bases(100 bases per row)
TTATAATCCACGATGTGTGTTTTGCGTGTGATTTTGTAGGTATAACCCACTTGTATGTACAACTGTGTAAAACTGCCTTTATAACCGGACCTCCAATTGA
TGTGTAACTTCGGGGAGATGAGGGAAAAACTGGATTTGTTATATGCTCCATGAATGATGAGTGTTTTGTCTCCCGCTTCTTCTCGGCTTTCGGCCACGGG
ACTTTCGTCAAGGTAGCAAATATAACACACTGACATTAGTGAGGTTAAACACGCCGCGAGGCGCCTACTGACTACCATTCACTAAAGTACTCAGTACCTC
CACTAAGGTATCGGAACCTTTGACACGGCACACACACAGAGTGTGTGTGTTTGCAATGGGTCAAACTAACGCGCGACCCAATTGCTCTGCACGCTGCAGA
ACACTTCCCCTCCTACGGAAAGTCCAGTGTCTTGATGAGGGCGGCCACGGCAGGGTCTTCCTTGTTCACCGCCGCCCACTTGCGAAATACGACTGGAATG
TCGTCCAGCAAATTCGCCGCAGGCTCCCAGGACGATTCCTCATCGTCGAGTCCAAGCCACTTCACCAAAGCTTGGTGTCGGCCATCCACGCAGCGCGCTT
CGTCGTTCAGGTGCTCCACATTAAAACGATTTGGGTGAGTCTTGCTGCCGCAAAAAATGTCAGAAAACACCAGTTTTTAAGAAACCACCGTGATACAAAA
TTCAGAGAATTCAATATTTCGTCAAATTTTGCGTTTTTCGTCAAATTTTGTGTTTATGAAATCCGCCATCGCCAAACGCGATCTGCGCCTCGAGGTCTTC
GGTCACCTCTCTACCACCTTCGTGGTACATCATCAATCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACCCCACACAGCTCGTCCAACATGCCAGTGCATCA
AA