Description :
From Genome Similarity Track
Location :
Scaffold_27:97291- 99037
Transcript NameFunction/comments
Albla_Nc14030510viral Atype inclusion protein putative

Sequence
1746 bases(100 bases per row)
TCCTTCTTGAAGACCATCAGAAAGGCTTCCATGAAATGCGTACTGAGAAAGAGGTGCTTGAGCAACAACTTGATGAGCTGAGTATCCGATCCAAAGAGAC
GAAGAATACGACGATGATGGCATCAGAAGGTGAGAAAGGGAGTGTTGAAGTGAGAGAAAGAATCAGTCTATTGCAATCCCAACTCGCTGACTCAGATATG
AAAATCAGTCTTCTGGAACAAGATCGATCAAATCGGGCGGAGAAACAACGGGACTTGAGTCGGAAGCACTTTGAGGCAGAGAGTACCTTGCGGAAGCTGG
AAGAGGAGAAACAAAATCTCTTTTCAGATTTGCAAAATGTGAAATTGGAAGCTTCCAAGTGGAAAGAAAAGGCCGAGCAAGCAGACAAAGAAGCTGTTGC
GTTGAATGCAAAGCTGATGGAGCTTCAACTTGAGAAAGAGACATTGGAAATAACGTCACAAAACTTGAAAGAAGCTGAAACGAGAACCCTTAAGGCGTCC
ACAACCTTCCAAAACACGAAAGAAGCCCTTGAAAAGCAAATTCAAGATCTCATCCAGCAGCTTTATGATGAAAAAAGTGCTGGACGAGCAAGTGCAGTGG
AGCTACAAGGCTCTAGAAATCGATGCAAACGACTGGAGAATGAATTGGAGTACTCCCAAGAACGCAACAAAAACCTTGAAAATGAACGAAATGATCTTGA
CTCGAAATGCAAAGCTCAACAACAGGAGAATCATGACCTGGAGAATCAGACACGAAGTATGCATTCAGACGGACAAGATTGGGAATCGAAATGCAAATTA
CTTGAAGACAATCTAACAGCCGCACTGGAAAAGGTCAAAAGACTCGAGCCTGATTTACTCGAGCAACAGACACGATACAAAAGAGAGCGCGAGGAGAAGG
AAAGTACAATCAAACAGCTTCGGAAAGCGGAAAATGAGAAAGTGGAACTCGAATCGGCAATGACATCTTGCAAACGTCGAGCTGAAGCATCAGAGTCCAG
GGCCGATGAGTTTGATGCAGCGGTCTCACGTGCCGACTTCCAAGCAACAGTAAAGCACCAACGGCTTCAAAAGGAACTGGACGCTTCTACTTTCACTACG
ACCTCTTTAGAAAAGCAGAATCGAGTCATGACAACGGACCTAGTATCCTGCAGAGAAGCTCTGCATTCTGCCAACACAGAGATCCTTCAAATACAAGCGA
AGCTAGATGCAGCAACGAAGGAGAACAGAGAGCTGAAAGAGACGATATTGATGATCAACGCCATGAAATCGCAATCGGAGGCCTCAAATCAGCAAACCTA
TCATGAAAACCAGTTCCAAGGCATTACGGCAAATGAGGATGTCACCCTGGTCAAACTGCATCTTGCTGATGTCAATAAATGCGAGCTGGAGTCTCACCTG
AAGGATGTTACAACCAAGCTCGAACAATCAGCTAGGCGAGCAGCGGTGATGGAGGATCGGTGCAAGCATCAGGCCATAGAGATCGAATCGTTGCTCAGCG
AGATATCATGCTTGCGCTCCAGTCTACAGAAGCTTCATCTATCCGCTATGGAAGCATTACCTTCGACGGAACGGGTCGAATATGAGCATCGGAAGCGACT
TTTACGGGCCGAGTATCTAGCTCAGCTTGGAGCCTTCCAAGATCGAGAAGAACAAGCTTTCATTCGGAATAAAGCTCGGTCACGTGCCAAATATGAGAAA
GAATTGGAAGAGCTGATTGCTGATTTAGAAAGACAAAAAGAACAAC