Description :
From Genome Similarity Track
Location :
Scaffold_178:97284- 102233
Sequence
4949 bases(100 bases per row)
GAATCACTGAAGATTGACATCTCCAAATGTAAAGCAGCTGAAGAAGATTCTCTGCTGAGATGGTTTGCTTAGCTAGGTGACGCCATAAGGGCTTTTCACA
TCGTTGATAAGCAAATGCAGGTCGCATTTGCTCAGTCAAACTTGGCAGGGAGTGCGACGACTTGGGCCTTGGGCCCAAGCTACACGACCCATTTGTCTTT
GGGTCGTTAGAAGTATTCAAGTCCCTACTTGGGCAAACATTAGAGCCACCGCGAGCTGAGTTCAGGGCTCGCTCTGAACTCCTGAAACTCAAACAAGGCA
AACGTGATGTACACTCGTACATTCATTACATACGTCATCTTACGAGTTGCATCACGTCCAATACGCCGAATTAACGAACCGTGATCACGTTGTTCATGCA
GGGTCTCACAGGCGGTCAAGTCAGGACGTATATCTTCCGATTGGAATTTGATACCCTGGAAGAGGCAATCTGGGTTTCGGGACAAGAAGATTTCATCGTG
AAACAAGCTCACGTAAGATCGAGTTCCTATCGTCCCCCTAGGCGACAGCAAATCAGAGTCCTAGAACTGATGGACCTCTGTTACGCTGAAAGTGAAAGCT
CTCGTGTTATCAACTACAAGAAATTGAAGAGGTGCAATAGATGTCAAAAACAGGGCACTATGCATTCGAATGCAGTGCCCCGAACATGGTACCACGTACC
GCAAGAAAGTGTAACCTTCAAGCGGCCAAGAAGGGTCCTAGGCGTGGGTTCGACGCTGTTGCGAAAACGCAACATCGTAACGGACGACCTAAAAACGGTC
AGGGTAAGTAGGTGCGGAGCACCCTATTGATCCAGCAACGTCAAGTGAATTTGCAGGTCTCTTGACGAGAATTGCTCCCAACACGCAATCATTGTGTGTT
ACTGCACCTGGTAAAGAGGTTTTCCTCATTACCTTGAAACTCGAAGTGGCAAAGGATATGTCACTATGACCCCTAGTCATTTGTGGGGCGTCAAACAACT
TATACGAAGCCAATAGCTAGACAATAGTAAGCTCAAATACATCGCACGAGAGATCCCTCCAACGAGGACGACAGTATGCCTCGCTACAGGCGCATCCGTA
ACAGTGATGAAACGTGTAGTAGGAATTTCCTATACACTGAAAGAAGTCCAATACGATGATGAATTCATCGTCTTGTACTTGGATGACAAATTTGATGTTA
TCCTTGGTTTACCGGGCTCAGAAGGTACGAGCCACAAGTCAGATGGCATCGACGAAGTGTCGATATGCCCGCCGCTTGTTCACCAGACGCCCATCTGATG
AACGTCTTGGAGCGTCCACCACCATGTGGATGTACTACGAGTAAGTGCTATGGCCTTACGTCTGGTTCGGTCGTTAGTACGACTGCACAAAATCACAATA
TGACTAACCATCATATTGTGGAGCAAGATTCCGCCGACTGCATAATAATGCAGGAAGCGCTGAAGGCCCACCTCTCGGATAAGTCGAGCGGACCGAGGCA
TGGATGTCTCCTTAATAGACAACACACAGACCATGACCAACCGATTGCCAATTATGGTCAATACGGAGATGGAATAGCCCAAGAGGCTAGAGTTGAGGGA
ATATGTATCCGACAAACAGTGGAAGTAAGTTCCCATGAGATGACAGACACATTGAATGTCCTGGTTCATGACGGATCAAGCATAGGTAGTGATACGATTG
ATCTGATCGCGCCTCCGAAATTAACTTCGGAGATCAATCAGTTACCCCCGCTGAACCAAAAGAGGTTCTTGCGTGATCTGCGTAGTGGCAACCACAAGCA
GATCTGTGTACTCGTCGCGGAGGATGAGTACGTCAGTGATATCCGATCAGCAATGGTATTTGCCGAAGAAGAACGAGTTTTCAGTAGCTCATCAGTAGAC
GAGAGTGTCCTTCATAAAAAGACTCGAGTTGAGCAATATACATCCCAATCGTGGGAATCGCTCAGAACAAATTCTCTCTACGATGATTTGATGGAATTCA
GAGAGATATTACTAGAAGCAGTCCCGTGCGAGTTACCTAAGGACAAAGGTACTCGTGACAAAATCGACCTGAAACCGGGTTCGAAGCACTATGTATTGAA
GCAATGGCCGCTACCTCGTGAGAAAGCACTAGCGATCGACAAATCGCTTAGCAGCCGGTCATGTGAGGGAGTCCACCTCTCCACATAGCTCTCCGACCTT
CTGTTTGCGAAAAGCCGCATGAAGCTGGAGAATAGTACACGCCTTCAACAAGTTGAATGCTGCCACTGTACCGGCTCAAACACCAATACCAAGGAAAGAT
GTCATCATAGACGGTATGGCTAAGAGTACCATTTTTTCATCCATGGATCTGATGGATGGGTTCGATCAGATCCTTATGCATGAAAGGGACATTCCCTATA
CTGCAGTTAGCACCCCAAGCGGTATGCTTTGGGAGTGGTTAGTAATGCCACAAAGGCTGAGTAATTCCCCTGCCACATTCAACAGATGCACATTAAACAG
ATGTGTAACGAATCTATTAAGATCCATTAAGAGAGTTGTCGCCCAGTTGCTTCGATGATGTGTTCGTCCATAGCCGGGCTATGGATGGACAGACAGATGC
GGAAGCGCACCGACTCCACGTCCGAAAAATTATTTTACTAATGCGCTAGCATAAGTTTTACGTCAACCTCAAGAAGTGTATATTTGCTGCTAGCGCAATA
CCACTTCTTGGCTGCTTCGTGGGTAATCATGGCGTCCGGCCCGATCCAGAAAAGATCAAGGCGATCACCGACTGGCCGGTGCCTACAAATGTCAAGGGAC
TTCAAAAGTTTCTTGGCCTAGCGGCATATTTGCACAAATATTCGTACAATAACGTCGAGATGACTGTTCATCTCTCTCGTTTTTTTAAGAACGAGTAGTG
GGGATGGATTGCCGACTGCCAGAACTCTTCCGAAGGTATCAAGAAAATCTTGATACGATCGCCAGTATGGCAATTGCAAACCAAGACAGGCCATTCCACG
TGGTCTGTGATGCCGGCGACTTTGCAATCGGCTGTGTATTAGTGCAGTATGATGCAGACGATGCGGAGCGTGTCGTCTATTACCAGTCACGCCAGCTGCA
ACCAGCTGAACGCGACTACCCCGTCCATGACAAGGAACTTCTTGCCATGAAGTACGCGCTGGCTAAGTTCAGAGTCTATCTGCTAGGTGATAGATCCTTC
ATCGTTTTTACCGACCATGCGTCTTTACGCACGGCCGTAAACAGTCCACACCTCTCGCAGCGGATGGCGAGGTGGCTGTCATTCTTTGCGGAGTATAACT
TCTCCGTCGATTATAAGCCAGGACGACTTAACGTCGCCGCTGAAGCACTCTCGCGCCGGCCCGATTTCGAGCCGGCTGCGCCAACCGACACTGGTCCGAC
CACTGTCGCGGTACTGACTTCGAGTCTCCTGTCGTCAACCTTATAGGAAGACACACGAAAGGCTTATGACCCGGGAATGGTGAGATTAATGTATCATCTC
TCGCACCCATTAGGAAAGAGCCTCAAACATTTGTCGTCAGTATATCGATCCTTCACGGATAGATACAGCTCGCAACGGCTTACTCCAATATTCGGCTGTT
TCCGACGACACACCTTGTGTCGTCGTACCATGGTGATCTGCGATTGCGTATCATGTACGAGTACCACGACGCACCTGTTGGTGGACATCGTGGTCGTGAG
AAAACATTCCTCACAGTGAGCCGCGACGTTTACTGGCCCCGCCAGTATCAGTTCGTGCGCAAGTACGTTCGGGCCTGTGAGGTCTGGCAGTCCTTCCCTT
AAATCCCCGTTGCAGCCTCTGCCCGTCCCGGCCGAGTGCTGGGGATCCATCTCAATGGACTTTGTCGTTGGATTCCCCGCAGACTCTCACAAGAATTCTG
GTATTCTTGTGTTCGTTAACATGTTCAGCAAGATGGTACATCTGGATGCTGTACCCGAATCAATCAACGCATCGGCTCGTGCCCGTGCCTTTATCGACAA
GGTTTTTTGCCTTCATAGGCTGCCTCGTGAACACGTGTCAGATCGGGGCCCGCGGTTCACAGCTGATTTTCGGCGTTACGTGTTCAAAACACTCGGAACG
CGCTAAAGATGTCCACGTCTGACCATGAAACAGGTGGTCAGACCGAACGCGCTAATCGTGCCCTCGAGGAGATCCTTCGAGGATACGTCCATTCATTTAC
GACTTGAAGCGAAGTCCTGCCGATGGTGGAGTTCGCCATCAACAATTCAGTCCATGCGTCGACGACGCACACGCCGTTCTTCGTGAATGGCTTACGTCAT
CCGCGTCTTCCCACCTTTTAGAGTTTGACTCTCGTTTAAGGAGGGGAGGGAACCATTCGAGCGACCGTCAATCCGGCTCTCACTCGTCATGTGCTGACAA
TGCGGTCACAACGTTCGACGCCGATGTCGATCACATCAGCTTTGGTGAAGAAGACGAAAGTAAGAGCGAATATGCTCCTACTGGCCACGATACTGATTAA
ATCAGCATCACCCCTAGTGCGTACAAAGACACACTCACAGAGGCGACAAGTGATCTTGCTACAGTACGCTCCAAGAACACTGCAGCAAGAGACAGCGAGT
CAGCAGATGAATTCATACTGGCCCGCGAAACGGTTGTCCGTTTCGTACAAGACTCTATCACAGAGGTGGTAGATCGTTTTAAACGAAACGCTGACAAGAA
TGTAAGGTCAACTGTCCTTTTATTCAATAAAGGCGACTTAGTCCTACTATCTACGGTAAACCTACCTCGACACATAGTGACTAACGTGAGTATTAACAAG
TTACTACCCAAGTTCATCGGTCCATTTCGTGTGCTGCACCACCTAGGCAACGCATATACGATTGAACTGCCACGTAAGATGCGCACGCATCCTAAGTTCT
ACGTTGGTCGCCTTAGGCCGTACTATCAGTACGGGGCTTCTTCCGGTGA