Description :
From Genome Similarity Track
Location :
Scaffold_29:97284- 98462
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_06963predicted protein
Sappa_CBS223.65SPRG_06964uncharacterized protein CPUR_03102

Sequence
1178 bases(100 bases per row)
AAGGCCATGGAGATCTTCCTGCAGCTCGCGGGTCCGCGCTACAACAAGGACAAGCGCCTCGTCAAGCTCGCCGAAGACCGGTACGACAAACGCATTTATA
ACCACAAGCGCCTCTGCGTCATCCTCCGCGACCTCGTCACGGCGGCCGTCGAGTTGAGCAAGAAGCAGCAGTAAGAAGTAGAAACAGCAGCCCGCTACAC
CAATAGATCGTTTCGCAGTGTATGCCTCCGATTGCAGTGGACTCTGCGCCAGGAGACCGCGCCTGCAGTCCTCTGCCCTTTCGCGTAGACAGCCAGGATC
GACAGCTCCGCCAAACGGGCTACTGGCGCGTGATGACGCCAAAGCAAAGATGATGACGCCAAAGCCAGTCACCGTCGGGCCGTTGCTGATTGTGATCGAA
GGCCCAGGAAGGTCATGCTCATGCATAGCGTCTTCTTCGCTCTTTCGTCGTCGACCGCAGAGAACGCTTCTTCGATCGCTCACAGGTCTTTTGCCTGCCT
ATACGATAGAAGGGCCATTTGAAAACCACTGTCGGCTTGGCGCCAAAGCTTGGACACTCTTAACAGGGGTGCATACTGACTGGTATTAATTTATACTTGG
TTGTGGCCCTAGCCCTAGCCCTTTTGCCTCCCCACACGGCTTGTTGCCGGCGACATCGTCGTAGTACACGGCAAGGCCTGTGGCTTCTTGACGATGCAAG
CGCCATTGCGCACTGCTGGAACCACGGTAACCAAAGCAATCCTCTTTCTTTATACGCGTAGAGTTTATGGGCGGAGGTAGAAGAGCGCACCACATGTCGT
GTACGACTGCATGTCGATCTTTTGGTCGAGCGAGATGCGACCACCGGGCATCGCCAGTGGACCGATCTCGCCGCCGGAAATGACGCCCGCGAGCGGCGTG
TTTGGAAATACGCTAGCAAAGGTATCGGCCTCGACGTCAGTCTCGCCGTAAAAGCCTTCGCCCCGGGCCGCGCACGGGGTACGTGAGCCCGCCGAGGATC
GTGGCACCAGACGCAGCGACCTTGGCCAATGCGAGCGAGTGCGCGAGGTCGGCTTGGCCGGCGACGGCGTCCTGGACGCAGAAGACACCAAACATGCCTT
CGCGCCACGGCGCCGCGCCACTCTCTGCGTCCGCTTGGGAAAAGACGATGCCGTGCTGCTTGTCGTAGATGCACACGG