Description :
From Genome Similarity Track
Location :
Scaffold_92:97255- 101186
Sequence
3931 bases(100 bases per row)
TCGACTTCATACTGGTTTGTACTTGTGTCTGGTTCCCAGCTGTCTTCAGGCAGTAATTCTTCATCAAAGTCAAATCGCTGAGTCTCTTCGAGGGCGGCGA
TTAGCCTCGTCTTTGGTCTTCCGCCGAGTTCGGTGACTGCCTTCAGACGTGATACATGGACCACTGGGTAGAACCTATATCCACTCTTGTCGGGTAGCTC
CAATTCATAGGCAAATTCTTCCACCTTCTTCTTCACCCTGAATGGTCCATGCTATCGGTGGGCTAGCTTCTTGGTCAGGTCCGACTTGACTCGCTCCATA
AACAACCAGACTTGATCTCCTTCTTTGAACAAGGATTTGGTGGATTCATCGACTGGTTCTGCAACTTCATCTTCGTCATCTGCTGTGTTGGGAATGGATC
TTTTCTCCTTCTTGCTCAACGCTTCGTTGTGCTCTCGAGCTCGTCGTGCTTTCTCTCGCACTTGGAACTCAGCTGCTAATCAAAGTGGCACTTCTCGTTG
TCTGTTCGCTTCTCGGCGCCACTCGACTGCGTCCGCCGATTGACTGGGCGTCCCTGTCCACGTCGTATTGAACTCGTCATAGCCTTGAGTGTAGACTTGG
CGTCCCAACCATGCACCAGATAGAAAGGGGTTTCTCGCCGAGTCGAATCTCTTGAGTTGTTGATAGCGTGTACCATCTTCTCGGCGATGTCATCCCAGTC
GGCTTGAAGTGGGTCTTCTACGTAGACCCGTATAGTCTGAACCATTGTCTTGACTGACCTCTCTTGTTGACCGTTAGCTTGTGGTCGGTAACTCAGCGTA
GCTCTTGATCTCGACTGCATCATCTCGGAGAACTTTTGGAACACTTCACTCATAAACCTTGGATCTCGGTCGTGCCGTATCAGAGACGGAGCCCCGAACT
GCCTGAAGACGCATTCCTCAAATACCTTGGCCACTTCGAGTGCTCCGGTGTCATTCATAGCCTTAGCGATAACGAACCCCGTGAAGTGGTCCTGGAACAG
CAGCAGTGCAGTATTGCCCCGCTGAGTTCGAGGAAGGGGAATCACGAAATCCATTGACACGACTTGGAATGGATGGTCTGACACCACATTTCCCGGCGAA
TAACCTCTCAACTGTGGCTTGCTCTTACTAGTATTGCAGTCCTCGCAGGCCCTAACATGTTTCACCACGTCGGCGTAAAGACCAATCCAGTAGTAGTCGG
CTTTGACTCAGTGATACGTTCTGACGATGCCTTGATGCCCTCCTTCGATCGAGTTGTGGCAGTTATGAAGTATTTCGTCGACCATGGTTGACGGAATCAC
CAATCTCAATGAGAGGTTCGGTTCGCCGAGTTCGCCTAGTCGGCGGGCTTCATCTCGGCGGTATAACAGGCCGTCTTCGCTGAGTACAAAGACTTCTGCG
ACTTTGCCGGCATTCTGAGCTCGACGGTGTGTAAGGTCCTCCAATTCACCTTCGCGATTCGTCGTCTCCGCTCAGTCTGTACCATCACTGGATCAATGTC
GTTGGCATTCTGAGCTGTCTGGGCTGACTCCATCTGCGACCCTGTTTCGACATTCGGGGTCGTGTGGTTAATCCGCCGAGTCGACGCCCTGCTGACTTGT
TCGAATTCATCTCCACTGCTTTCAAACGCGGATTCTCCAGGATTGGTAGACATGGCTTCATGATCCTGACTTCCTCCTCTTGCTCTAGCCGAGTCTTCAT
CCAGCTCGTCCTCAAAGTGAACTCGGCGTACTCGGCTACGAGTGACTGCCGTGACAATCGGTGTTTCCGCTGGGTTGTCTGTGGCGTACAGTTCTTCGGC
TACACGATTAATCATTTTCAGCTCTGCTTTCCTATCCGTCCCAAGAATTACTCGTCCAGCTTTAGCTTCCAGTGCTTCTGTAGCGAGAGAATCAGCCGCT
GCGTTATAGTGTCGCGCTATGTGTCGATACCGGACCGAGTTGAGTTGTTTCGTGAGATCCTTGTGCCGAGCTAGTTCCACTTGCAACGTTTCCTTCTTGC
ATGCTATCACCCCCATGGATTGCTGGATTGCAAGCCGGGAGTCACCCACGATAATCAGATCGGTTATCCCTCGGTCAATCGCCGCCAAGACTCCATTGTT
CATGCCGGTGTACTCGGCGATGTTGACTGTGGTGGACGACAGGTACGCACTCGCAGCAATCTCAATGTACCAATTCGGAAGGCGCCACAGTATCCACGAA
CAACTGCCATACCCGCCGTATTTAGCCGTCTTCGCTGAGCCATCAAATGACAGCACGCATCCTGCAAAGTCAGCTGGTATTCGGGCATATAGCAGCGCTG
GGTCCATTCGAACTGTCGCCGAGTTCTTGGAGGGAGGTGCCAGGTGCTTCAAGGAATCGTCGAGTCCGATAAACGGGGTTATCGACGCCTGGAGCAACTG
GGCGAAGTCTACATCTCGCTCACGTACTCGTTTCACCTTCAAATCGTAGGGCGACAACATAACTGCGAAACTGACTGCGCGACCGTACAGCGACTTTGAC
TTAAACACCCACTCCAGCGTGGAGAAACGGGTGTAGACGTGAAGCGTCTTTCCCGCCAAGAGAGTGTAGCACACTTTCAGCAATTGCAACAGCGCGACTA
CTTCTTTCTCAGCGGGATGATAGCCGAGTTCGCTCTCCTTTAGTACGCGTCCGCAGAAGCGAACTGGTGCAGCTTGTCGTCGTGTGGTTGCATCAACGTA
CTGCTCAGCGCCCACTCATTGGCGTACAACATTATGTGGACTTCTTTCGCCGAGTCGAAATGACGCAGAATTGGAGCTTCTGCTACCCGTCTTTTGAGCT
CGGCGAATGATGCTTTTGCTGACGCCAGGTCACCCCCAGGGCCAAAGTCCGTATCCTTTAGCTGATAGAGTACTGCTCCGTAAACAGCCAAGTTCTGGAT
GAATCGGCCGTAATAGTTGAGGGCACCGAGGAACGCTTGCATCCCCTTCTTCGATTTCGGGAAGGCGAGCTCGGCGATCGCGGCTATCTTCTTCGCTTCA
GCGCGTATGCCACTCGGCGTAATCTCGTGCGATAGGAAATCAACCTTGGGTTGGATAAAGATACTCTTGGTAAAGCTGATGCTAATTCGACATTCTGTGA
ACCGGGCTAGTAATCGGTCGAGTGTCTCCAAGCAGGCGTCGAACGTCTCCCCTCCAAAACAGATATCATCGACAAACGACCTCCGCTTGAACACCGGAAT
CAAGGAAGACTGGTCAGGTTCTCCATCAGCAAACATGTCGCCGTCCGGTCCATTGACCAGGTCTTGGACCGGATCGCAGTCAGCTTGTGATTGGTGGTCA
GCTTCAAACTTCGTCAGCTGACTCTGCGTTGAATCGCTGATTCCGTCGAGCTCAACTCGCCGAGTTCCCGACTCGGCTTCAGCAACAGCCATTCGTTCGG
CAAACAGTTGCCATCCTCCCTTTGGTTGAACGTGTCCCCATAGAGCGTTGTCGATTAGTCGCTGGTAAATCATAGGCGCATTCTTCAATCCAAATGGCAT
TCGTAACCATTCAAAGTGTCCAAGTGCACATACGAACGCTGAGATCTGCCGAGCTCGGCGTGTCATCAAGACTGCCCAGAATCCACTCGCAGCATCGAGC
GAGCAAAACCACAAGTAGCTTTCCAATTCGGTAAGCAGGTCATCAACCAGTGGCATAGCGTATTCCATCGGTGGCGTAACCGCATTATCAGTTTATAGTC
AATGCATAGTCGAATATCCCTACCATTTTTCTTGAGCACTATCACCACTGGCGAGGCCCAAGGGCTGCTCGAGAATGATATCAACCCAGCTCGAAGCAGC
CCCTTCAACAACTCGTAAAGTTTGCTCAAGTGGCGGAGAGGTATCCGCCGAGCTCTCTGCTTAATGGGTGCGTGTCCTTGAACGTCGATGTCGCACAATG
CTCCGTACGCTGGAGGCGGCAGGGCATTACC