Description :
From Genome Similarity Track
Location :
Scaffold_3:97239- 103702
Transcript NameFunction/comments
Physo_127818hypothetical protein
Physo_159168PsAvh212
Physo_127819hypothetical protein

Sequence
6463 bases(100 bases per row)
GAGTTGCCGTTGTATCGTCGAAGGAGTCGCTTTGGAGGATGACGCCACCCCAAGGCTCATCATCGACGTCATAAGCTGTAGGAACTGGGAGTACCGAGAC
AGACTGCGAAAAGAGAACTGCGCTACTCGAGCCATCACCTTCTATTAGAGTAGCCACATAGTCAATCTCCAAGTTTCCGGTGGTTTGTGCTGTCGCGATA
ATGCCACTTGCAACCGAGATACTGGAAGTAAACACCACAGAGCTGGGGTTAAAGCTCACTCCAGAGCAGGTCGGCGTCACCCGCACTGCCTTTGAATCCG
TTCCAGTCAAGTACAGCCGAAGTTCGAGCCCTTGGACAGATTCAAGAACGCCGAAGTGTGCAGGCAGCGGAGTCGCAAATAGCTCGAGAGAGTCCAAAGC
CGTTGATTGAGCTTGGGAAGTGTATATCAACACCCCAAATGCTGCAGCAAAGAGCAGGAGGGCTCTCATCGTGGCAACGTCTTGCCACGCTGCTCCTTCT
AGCTGACCCGGACGGAGTACCTGGACGAAGTTGCCTCCAACACTACTGCTTCCTTATTGTCGTCAAATAGCACTGAAGCTCACGGCCTGGTATTTCAGGG
CATCAGCCACCAACATCGGGGTCCTGAGTCCGCCTAAATAAACACTTGAACCGCAAAAAATAACTTTGCCCGTCTTCACTTCCCATTCTGGTTCACATAT
TTCCTCTAACTTAGTAGGCCGAGTGCGTCTCTAGCAATCCTTGAGCAGCTTCCGCCAGCGCATTCGCTTTCTCAATGGCCTGCGTCACAGCAGCCAGAGT
CTGGTCACTAGCACGAGGGCCCGTCTTCTTGGCCCCACACAAATACTGCTTCACCAGCTCCAAATTTCCAGCAATGCGCTGGCCCTCGTCCAGGACCCTC
GAGAGCTCGAACAAACTCTCGTCTCTGGACGTAAAGTTGCGCGCCATTTGCCGCTGCACGCGCTGCAGCGCCGCCTGGGCGCTGGCCAGCTCATTGAGCA
GCTCTCTCAGGTCCTCCTCCTTCTCCTGCATCACATGCTGCTGAGCCTGCAGCAGCGCCATGGCCTTGATCGCCCTCTTGGTCCCTGCCAGCGTCTCCAG
CACCGTCTCATCCGTTGGGGTCTTCCCCTTGACCACCAGCCTCAAGGCCTGGGGCGAGCTCAGCCCCAGCACCGCACTCACCTTCTTCTTGACGTCTAGC
ACGCTGCCGGAGCGTGGGAAGATGACGTCGTAGCGGCTTTTGCCCCTGAACACCTGCATCAGTAGCAGACCGTCTTCCAGCTCGTTCACATCGATCTCGG
GGGCTCTAGAGACCGGTTTGGACCCAGAATTTCTGGGTTCAAGGGGTGACTCGACTGAGGAAGAGGTCGCACCCGATTCTACGCGCTTCGAAGCGCTGGG
TTGCTCGTGGAAGGCGCGATTGCGCAGCAGTAGCAGCTTGCAGCCGTCCGTGAGCACTGAGGAGCTGCTCACGTCGCGACCGCGAAGCACCAAGCGCTGG
AACTTGGGCTCGAGCTGGAACTGGTCGCAGATGCCCGCCTTGAGGTGCTCGAGAGCCTCCGGGTCTTGCGGGGCCACGGCCACGGACGTCGAGAGCTTGC
CGAACACGACGGTCACTTGCAGCTCGTCCGCCATTTTTTGGTCGCAGATTTTTGTCCTGCCAGAAGTGATTATTTGCCTGTAATAAATGACTTGTTAGTG
CATAGTTTAGACCAATCCATCTACTGCACTTTGAAGTACATGTACTTGCGTATGTCTGCATCAAACTCTTCAGGTGCACATGTGCTCGGCAGCCTGAAAT
GAGTATCGTGGTTAGTGAAAGGTTACTACCAGCAGTAAGCGTATGGTTCGTGATGCATTAGCAGATGGCACTTTCAAAGGGTGGATTCGATAGCTGCATC
CCCACAGCACAATTCCTCCGCGACACTGTGGTTAATGATTCAAGGGCGTTGTATTTTTTATTTGTACCTGAAAGGAATATAAGTTTAAAGTAAAAAAGGA
ACTCAGTGCTTGTTACCGGTACAGTACATGTAACTGATTGCGATCGAATCCTGTGATACCAATTATCCTGGGAACGTGAATCGATCGTATGTTTGCTTCG
TGAATCTGGGGCTGTCGTGCACGTGAACGAATAGTACAGATTGTCAAGAATTCTTTTGCGATCGTTTTATCCTTACCAGCGCGAGTCGTAAACAATCCCG
TCCGTAGTGATACGTGTACATAGTTTCAGGGAAAATGACCAAATCGGTATGAAATCAATTTTAAATGCCAAATCGGTATATTTCGTGACTGAATCCGTAT
GCGTTAATTTTAAATATTGAGGTGCGAACTACCACGCCACGGACGCCCTCGCTTCTTGCAGACTCCAAGACAAGTGTCATAACATTCATGGCATGGTTGC
TGTACTTGTGGTATGAGTACTTTCAGGTAAGGATATGATGAAAACAAGCAAGTAGTCCACAATAGACAAGCTCACAACTAGGTGTTTAGTTCGGGCGACC
ACCCGACCGGTATGCGTGATTGGGGGGTCATACCGCTTCAGCATTTAAAATGCGATTTCATACCGGTTTAGTCATTTTCCCCATAGTTTCAGGACCACTC
TATATCACTATCTAGGGGCATCACCACTTCAACGTACTATATCATTTAGGCACTTGGTGAGCTTGCATTGCACTCGATACGTAGTCAAATGCAAGTTGAC
TGTTGTGCTGGAGATTATACTATCTACAGCTATCGGCGCGAGGGGTGATGCTGCTTTCAGATGGACTTAAAACTACAACGCGGAATCTAGTTTAGCGTCC
CAAATGATTAGCTAAATGCGTTCCAGAATAACCTGATGCTAGATACTTCCTATAGTGCGATTCAGGAAAAGTCGAGCGTATTTGACGTCACAAGCGACCC
GTGCTGGGGTTGAACTTTGCCGGACATGTTTTACGAAATGGACTTTCCTTAGAGTTTATGCCCTTTTGATAGTGATACATACAAAACTGGTGTTTATCAC
TCGGTCGGGTGTTCCAGAGATTGGCAGGGGTAGGTGAACTCGGCCTCGAGTTTTCACTTCTGTATTCTTGCTCATTTTGGACATAACCATTGCAATTCGC
AGAGAACCCGGGAACCAGCAAGGGGATCGAGTTCCCGGGTTCTCGGCGAATCGTCATGGTTATGTCCAAAGTGAGCAAAAATAATACGATATCATTTCGC
ATATCACTTGCCGTCCCGACCGAGAACCAGCACCAGCCAGCGCGACCAGCCTCTTACCTGGTACATGTCAGAGTACCCTTTTCATTCGAGTATAGGTAAT
GAACGGCTCGATTCGAGTGTGGCCTTGGCCCTCTGGGGTACAGGAACCTCCGATACAACTTTCTTATCCACCTTTTTGAAGACACTGAGGCCCTGGTCTA
AGTAAAACTGTGCTGAGATTTGTACAAGGGACTGGGTTAGGCGAGCACGAGTTTGTAGTCAAAGTAGACGAGTTCCGAAGTTGGTTCCCAACTTAGAACC
TGGTCAGCACGAGTTCTGAGAATTTGTGCGGTACTATATCTGGCGTAAGACATCGAAGAAGCGCCGAAGAAAGCTTGGCTTTTGCCGACCTCATTTTACA
ACTAGCCGTCTCGAGCCCTCCCTCCCAGCCACCCGACCATCATGTACGCGAACGACACCTCGTACAGCTCCGCCGCCGTGAGCGGTGCTATTGAAGACTT
CATGCAACTTCCAGCACTACATAAACCACAGGTAGCCAGACCACGTGGTCGCGATACAGTAATTGCTCCTCAACAGCCCTCGCAGAGGAAAAGCAAAGCT
GAACAGATGATCATCGTGTCTCTGAAGGTTACTGAATCAGTATGAAAAAAACTTAGCAGAATTAAAAACCCTCAAACATGTGGAATATCCTAGGATACGC
TGTCCTATCCTATGGCATTGCCCGCGCAGCTCTGTGAACAAACCTTGTTGTCGTTCGGAAGAGTCTCTCATTCCACAATTTGCTCGACACTCCACAACTA
CCACCACCCCCCAGGACCATCTATCGTCTCATCAACCAACAAGCATGCGCCTCACCTACATCCTCGCCGTCGTAGTTGCCGCTACTCTCCACGCAAGCGG
CACCGCGCTCCCGACCACCAAGGATTCCAACCAGGCCGCGATCTCCAACGTGGCGTCAGCTGGCATCGTCCCCACCGAAGAGAACGGCGGTCGGATGCTG
GTCGAGGAAGTTAAAGAGGAACGCGCAGGCGGAGCCCTTGTTAAGTGGTTAAAGCAGCAAGGGGAGAACCTGAAGTTCCACATCAAGAAATACATGCCTG
GAACACACGAGAACAAGCTTTACACGGATGTCCAGCAAGGAAAGAGAAACGCCGAGATGCTGAAAAGGCGAGACTCAGGGATCCGCGCTGCAATGGGAAA
CTGAGGAAGCGCATACTGTTCAGTGAATTCGACACATTTCCACTCGCCCGCCTATTTTCGTTTTTAGAGGTTGCTTCGAGCCGCGTCCCATTTTTTCATT
CACACAGGCCTCTGTCTGCATAACAAGAGAAGACAAGACAGCAGTCCAACTATGAAGCGAGTCTCAACACCGCTAGCGCTGTCGCCGTGGGAGCAGTTGG
TGGTGGCCAGGTTCGCGTACGCGCTGTTCGCTGTTCTGTCGGTGCATCTCGTTCTGCTTGCACTGTGCTTGGCGATTGTTCGGCGAGGACAGACGCTGCT
GTTCGGTCAGTGGGAGGAGATCTCCGGCGTAAAGCTGGTGGCGTGGGCTGCGCTGCTGTTCTATTGTGGTACTAGCGGCCTACTAGCACTCGTGCTGAAG
AGTAAGCGAGCGGCGGCCAAGCACGCGCTAGGGTGCTGGATGCTGTTATTGGTGCTGCACACGTCGCACCTTGTCGTCACGGTGTCGCCTGCAGTGCCCC
ACGATAACTCGCACTCGTGGACGACATGCCAGATGATGGTGCAAGTGCTGACGGACGCCATGAGCTGCAGCTTCCTCGTCTGGCTGCTGCGGCAACGAAA
TGGCGTCCACGACAAGGAGGATAGTTTGCGCCAGCCTCTGCTTCCAGTTGTAAGCATGGAAGATGCTCATGATGGTGCCGAGTACAGTAGCCGAACCACA
TAGCGAGCTGACGTTGAAGCCGTAAATCGCATCGCATTCCTCAAAAGTCTTCCTTTATGTCAATGAAATAAGCGTCCGCAAGGAACAGGAGCGCAACGTT
GCCAACGGTGGTAAGCGACACAGCCCACCACTAACACTATGGCAACGCCTCCAACCTCCTCCGACGTTCTACTGCCTCTGTCGCCCATGGACGCGGTGAT
GCACAGCTTCGGCTTCGTGATCCTCTACATCTTCCCACCACCGGTAGAGCCCCCCCACGACCTCGACAAGCTGCAGTCGTCCTTCCTCTCTGCTGTGAAC
GAAGACTACCCGATCTTCATCGGAGAGCTGTACCTGGACCCCAGTACGGGGGTCGTCAACGTGAAGCAGACGGCGGAGTCCCAGCGAAAGGGGGCGAAGG
GGATCCGCTTCGAGACGAATTCCAGCAGCCCCTTGACGACGGAGCAGGCGATGCAGAAGCGTTCGTGGGATTTGATGCCAACGACCCGAGGCAAGACGGA
GCTCATGTGTGTGAAGGGCTCGCTGCTGGCCGACGGAGGGTTGGCGATCGGGGTGGACGCCAGCCACACGCTGGTGGATGGGGAGGGCATGTTCACCTTT
ATGACAGTGTGGGGGCAGCACTATAGTGGCGTCAAGAAGGAGGACCGACTGGTTGTGTGCCATGACAGGCACTTGCAACAGGGAACGGGTACACCATCGA
CCATGCAGCACCCGGAGTTTCGAGTGGTTGAAACTGCGTCTGGAGGTGAAGCTGAAGCTGAAGTCAACGGTGGAGAAGCTCCAGCTCCGCCGTCCACAGA
CCACCACTTGTTTCACTTTACGCCCCAGATGATGAAGAAGATCAAGGAAGTCGCGACGCGCGGTGGGTTGTCTGTTAGTGAGGATGCAGGCGTGTCGTAC
GTGAGTACTACGGACTCCATCACGGCGCTCTTCACTGTGTTGATCTCGCGAGCGCGCGGCCACGGGCACGGCGTGAAAATTACGACTGGCGTCAATGCTC
GACGTCGCATGGAGCCGCCTTTACCAGCAAATTACGTTGGGAATGTCATTTTCAACGCGCTATCGACCTACAAGAACGGCGAGTTGCAGCCTGATGAAGA
CGAAGCGGACGACGTTGTCTCGCCAGCAAAGCTGGGGAAGATAGCAAGGCGCGTCCGTGCATCGATCCTCGAGCGCAACGGCGAGTATCTCCGAGATGCC
ATCAACTTTCTGACCGAGCAGCGCAACATTTCTGCTGTGCAGGTTGGCACCAACTTCTTTTTCGGCCAGGACCTCATGTTCACGTCTTGGGTGCACATGG
GTATGTACAACGCGGAGTTTGGCGGCACTCGGCCGTGGTATGCTTGCGTCCCCAAACTGCCGT