Description :
From Genome Similarity Track
Location :
Scaffold_1322:972- 3439
Sequence
2467 bases(100 bases per row)
GTCAGACCGGGATTAAGAGTGAAGATTGTGAGTTACAAGAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNTTTGCTGATTAGGGAGCAGTTTGTGATATATATGTGGGTGGGGCCGACCCGGTTGCGCAGAGGGTCATGCCTGTGGCCCCCAAATTTC
GAAAAAACTCGCCGGTCTGATTAAAGGATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGACAAGAGA
GATTTCCGCTTTTGTCACACCATCATGGTTGTTTAAGAGGTTACGGATGCCTTTCGGGTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACCGATGCTGAACCAGATA
CTGATCCGGAACAATCGGTGTTGGTTCGAAGATCCTATATCGACGACATGTTGATACCAGCTACGTCGCGGAAATATATGTGCGAGAAAGTGGAGAGGTT
ATTGGAGGCGTACAATAAGTGGAATTTGTCGATCAGNNNNNNNNNNNNNNNNNNNNNNNNNNGACGTCGCAAGGTAGAATATCTAGGACATCAAATTTTG
CTCGTAGGCTTGGAAGCTAATCCGAAAGTTTAGGGATCGTTAGTGAAAATTCCGTTCCTTCGGACGCTGCGATCGATTCAGTCATTTTTGGGANNNNNNN
NNNTTGGTCGAAGATTTTGCAATTTACGTATCACTGTTGTACGAGCTGCGTGAAGCCGATTACCNNNNNNNNNNNNNNNNNNNNNNNNTGAAATCGGCTG
CGTTAATGAAGCTGCAAATGACATGTCTGGGGTAGGACGTGATGACATTCGCGAACGGTGTAAGAAATGATTGCGATCTATACCCAAAACGGGAGAACGA
AGTCGATCGGTACCGAATTACAGGGGACGACCACGATCTGTGCCCAAAACCAGAGATCGATATCGATCGGTAACCTATAGCAGGGGGCGCTTGCGATTTC
GAGGACAGGAATCGTTGGGAGAAATCAATGATCGCATTCAAATTGCTAAAGGCGAAGATAGCGACAGCACCGATCTTGAAGCATTTCGACCCCGATCGAC
CNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATGAT
GGTTTATATAGGCCTGTCTCCTTCTCGAGTCGTACCATAAAGCCTAACGAGGCTAATTACTGGATGGTGGAGAAAGAGGTGTTAGCTCTTCCTCCGGATA
TCTGTTATGCTATGAAATAAAAATAGTATCCCGCGAGATTACAGTGCTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGACGATAAGTACGCCACCTCCCACAGTGGGAGTGA
ATGAAAACTTGCTAGTGGCCATTTTCGATGAATCGGCTATAGTAAAGAGAAATGGCGGAGCATACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGGTGATTATCTGCGGGGATTCGAATTTATTGATCCGCCGAAT
GCGAGCAGAAATCGAATGTAAGGCGCCAGGACTAAAATCGATGAGACATATAGCGATGGAGAAACTC