Description :
From Genome Similarity Track
Location :
Scaffold_1111:972- 3158
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_1111-fgenesh-gene-0.0DEAD/DEAH box RNA helicase

Sequence
2186 bases(100 bases per row)
GAAGAAGCCCGTGGAGAAGAAGCCCAAGCAGCGCGAGCGCAAGATGAGCGTCGACATGGTGCCCAAGTGGGCGGGCAATGAGGACGCGGCTGCGAGTGGC
GGCAAGAAGAAAACCGGCAGCAAGCAGAGCCGCAAGCGCAAGCTAAGCGAAGGTGCGATCGAGGAGCAGAAGCTCGAGGATGACGAGCGCAAGCAGGCGT
CGCTGCTGCTTGCGCCGCCCAAGATGAACAAGGCGCAGAAGCGCAAGCTCAAGAAGCAGCAGCGCCGAGCGCGCGCGGCCTCGATCGGTACGTTTGTGAC
TACTGCCCTTATTTATATACGTTTGGGAAAGTTAAGTACACATGAGCTGGCAGATACTGATTCTTATATGTTGCTGTTTCTTCAAATGCAGGAAGCGAAG
CCTCGTCCAGAGGAGACGAAGAGAGTGATGAGAGTGAAGAAGAGGACGATGAAGAGGACGATGGTGATGAAGACATGACGCTCTTCAGAAACGACAATGA
GGATGACGACGAGACCGACGGCAAGACGAAGAAGAGCAAGAAAGTTGCAAAGCAGGAGGCCGCGGCCAGCAAGGAAAAGTACGTACTTATTTACCACTTT
CTGGCTACTCACCAATGCACAGAGCTCATGGCCTTGCTTGATAAGCGTCGCATACTAACTTGCTGTCTGTATTTTGCCTGTGTCTCTATCCCTTGCTAGA
GACGAGATCATGCAATTTCGTCGCCAAATGAACATTCGCGTCGAAGGCACAGTGGTGCCAGCGCCGATCGCCGAGTTTACGCTCATGCGCTTGAACGCGC
GCCAGGAGAAGATGAAGGACGTTCTGCTCAAGAACATCGAGGCCTCGGAGTACAAGGAGCCGACACCGATCCAGATGCAGGCGATCCCGAGCATGCTTCT
GGGCCGCGATGTACTCGCGACCGCGCCAACGGGCTCTGGAAAGACCGCCGCCTTTGCAATCCCAATGCTCGCCAACCTGGGCGCGCCCGGACAGGAGCGC
GGCATCCGTGCGATTGTGCTCTCGCCCACGCGCGAGCTCTCGGTCCAGATCCACGCCGAGTTCAACCGCCTGAGCAAGGGCCGCAAGTTCCACATCGTGC
TGCTCTCCAAGGCCACGGCAGCCACGATCACGGCGCAAATTAAGTACGTTCCTTTTCTTCATTTGCCCTAAAATCGTTGTGAGCATTGTGCTTGGTGCTA
ACATTGTCATTGGTGCGTACTTACTTATCGAACAATCATTCTTTGTAGGAGCAAGTGTACCGTGAATCACGACATTGTGATCGCGACGCCGCTACGCCTC
GTGCACCTGATCCAAGAGACGAAACTCGACCTCTCGACGGTCGAGACGGTGTGCCTAGACGAGGCCGACCGGCTCTTCGACATGGGATTTGTCGAGCAGA
TCGACGAAGTCTTCGCGGCGTGCACGCATCCAAAGATCCAGCGCGCGATGTTCAGCGCCACGATGCTCCAGGGCGTCGAGGAGATGGCGCAGTCCGTGCT
GCGCGATCCGGTCAAGGTCTCGATCGGCGTCAAGAACTCTGGCGCGACGACTATTGAGCAGAAGCTCGTGTTTGTCGGCAAGGAGGAAGGCAAGCTCGTG
GCCATGAAGCAGCTCATCACCGAGGGTCTTCGTGTGCCGGCGCTGCTCTTTGTGCAGAACAAGGAGCGCGCAAACGAGCTCTACCAGGAGCTACTCTACG
ATGGCATCAACGTGGGCGCTGTCCATGCCGACCGGACGAAAGAGCAGCGCGACGACGTGATCAGGCAGTTCCGCACGGGCGCCATCTGGGTGCTCATCTG
CACGGACCTCATGAGTCGCGGCATGGACTTCAAGGCCGTCAACATGGTGATCAACTACGACTTCCCGCAGAGCGCCGTGAGCTACATCCACCGCATCGGG
CGCACGGGCCGAGGCGGCCGCCAGGGGCTCGCGGTCACGTTCTTCACCGAGGACGACATGATGTACCTGCGTGCGATCGCGAACGTGATGAAGCTCTCGG
GCTGCGACGTGCCCGAGTGGATGCTCGCGCTGCGCAAGACGAGCGACCGCGCGCGCAAGGAGCTGCTCAAGGCCCCTCCGCAGCGCCACCGCATCAACAC
GGTCTCGGGCTACGATCTGCAAAAGTCCAACCGCATGCGCCAGTTCAAGAAGGGAGCACCGGGCGATGAAGAGGACGGAGCGCAGC