Description :
From Genome Similarity Track
Location :
Scaffold_144:97194- 98504
Transcript NameFunction/comments
g18461.t1XP_008903391.1 hypothetical protein PPTG_10447 [Phytophthora parasitica INRA-310

Sequence
1310 bases(100 bases per row)
TACTACATGCTGTACATTTTCATCTTGTAGAAAATCAAAATGGTCAGGAAGCCCAGGAAGCTGGCGATACCTCCGACGAACACCGGCAGCTTGTATCCGA
GGGACGTTTGCACTAGCCCCGTGCCAATGGCAAAGTTGAGCAATTGGCCAAAGCAATTTGCAGAGTTTAGAGCCCCAACGAACACGCCTATCTCTTCGTC
CTCCCCAAAGACATGGATAATCACTGGAACGACGAGCGCGAACCACACGGCGTGCGTGATGCCGGTCGTGGCAACGACAAAGACGTCGAACCCAGGGCTG
CTGACCCACGCCATGGCCGAGTAAAGGATTTGAGGCACCGTTGAAATGGTGAGGACCCACTTCACGCCAATCTTGTGCACCAGGAACGGCATGGCCCAAG
CGCACACGTACCCCACGACGTTGTAAAGGAGGTCTGCTCGGCCGCCAGCAACGCTAACGCCGTGGTTGTAAGCATCCTGTTCAGCACTGCATGGGTCACA
ACTGTCTGCGTTTTCAGACTCTCCGCCGTATACCTCAAGCCCGAAGAATTGGCCCTTGTTGCCGTTGTACGACGTGTAGCCATACTGCGTGAAGAAGAAG
GCGACCCAGTACACTGCAAGGACACCAGGAAGGGTGCGGATCCCGTGATACACCGCAGCGAATGCGTGCTTCACCCGTGAACACGACGACGCTGCTTCCA
CATCATTCGGAGATAGCGGTGTTTCCTTCGCGAATACCACAGCGACACTGACGCAGATGAACATGGTCACGGACAGCATTCCCATGAACCAGTGTAGCGT
CTTGTAAGCAGCCCCGAAAAACTCAATGTAGCCTGCAATCAAAATCGCACCCAACGTCGCCCATGCCTGACCAAGAGCTGCGCCCGTAGTCTGGCGGTCT
CCTGCAAAATCAGCGACCAGAAGCATGGCCGGGGTTTGAACGATGTTCACGGTGATGTCCATCCAGAGGTAGAAAAATACAGTTAGGATTGACGTCCACG
TGCGATCGGTCTCGTCGCCGTCAGTGCCGTCGCCGTGGTCACCCAAGGCTTCGCCCATTTCACGCGTGTATCCCATGGCAATCCAGCAAACGATACTGAG
TACTCCAGCCACGATCAGGAACGGTCGACGTCGACCCATTTTCATGGTACTGCGGTCACTGAAGACGCCCACACTTGGGGCCACGAAGACACCAGCGATA
GGACCGATGAACTGAGTAATTTGCACAGCAAACCGCGGGAGCATCGTCGACAGGTAGGGGCCGAGTGCCGCCCATTGCGCCGCCCAGGCCATTTGAATTG
CCATCCGAGG