Description :
From Genome Similarity Track
Location :
Scaffold_241:97168- 98245
Transcript NameFunction/comments
Phyci_252929Hypothetical protein

Sequence
1077 bases(100 bases per row)
ATTCGCAGCACGCTCCTTCATGAAGTTCCTCCAAGAGGAAGGCGTTGGATGGGCCTACCTAGAATTGTGCATGCAGAGGGAGAGCGCCCCGCTCACTCTG
GAGGCTGTCGTTgacaagtttgggatgtaccttgctttcaaagagggccggaaggaccagggctcggaccgccactcagtcatgcagtaattccgacagg
ccaagaactggctgctagaacagttcccccaacatcgcgcggccgttgacaaagtgctgctcaaaaaaggacaagttcgcgagtacttcggcatgaagag
agagtcgggatctttcgtcaacaaggccacagcatgcacgaagaaggcgctcaagcacatgattgtgcatctctattcgacggctgttaccaatgacggc
taccaggatgcaggtctgctatgcctcctttggtTTGCTGGGACAACTACCGGAGCACCACACTGCTTCCCAAGCCGCGCTCACGCCAACCACGCCGCTC
ATCGATTTAATGGACCACCCAGAAACCGTACTCCCGCGCCAACCCGACAAAGCcaagtctcccgattcggcgcccggaacccacagctatgtcaatcgcg
ttcatgatagagtcgtaaacccggctggggtcgctgagcgcttgacgtctcactccttccgtcggggagaggcacaacacgccaacggagctggcatgtg
tgttcagcggatcttcgaccgaggggcctgggaaatgaccgcggaaaacaaagcgttcgcgtacgtcttcaacacaccgcctgaagaccacaaggtcgct
cgggtcttgagcagccgcgatccagacacgaatgttccgcttctcgcgctggacagcttcgactcccatacAAAGTCAAATATTCGCTCGGTGGCTTCGT
CGCTTCATCCGGACTGCATACTGCCTAGTACAATGTGAATGCACGGGTAGTCGACACGCAGGCGTACCTGTTACGCCACTATCCTAAATTGAAGTCGCTT
GCACCGGATGGCCTGGCGGTTCAGCGCATGGAAGCTTGTACGATCGAAAAATGCTTCTCTGTCAGCGAGCAGCTGGC