Description :
From Genome Similarity Track
Location :
Scaffold_7:9713- 11743
Transcript NameFunction/comments
Physo_305187unnamed protein product

Sequence
2030 bases(100 bases per row)
CGGCGCTGAGCTGCACGATCGCAGTTCGCGTTGGTTTCATATTTTCCTACTCTTTCCTTTCACATTAGCTACAGCTAGAGGCTTGTAGCCACTCTTAACA
TCAATCAGTTTTCATTTTTCGAGCAATCCAACAAGTGCAGACTCATCCACGTCAACTTCTACCAGAGCACGTGACAATTTCGAAATTAGAGTGGAAACCC
TGAAGAAAACGACAACAACAAATCTCTTGTAGAGCTTCGATAGGCAAGAAGACCGTTTGTTACCACGAATATCAGTCCCCGACAGTCGTCCTGAAACGAC
GGTCACTCAGCGACAAGCGCCGAGCCAGATCCTCAAGAGCAGATTATGCCGAACCAAGGAGAGAACAGTGAGCACGTCGCCGTCGGCGATCAAGTCATCC
ACCGCCGTCTAACTCGGCCCCGCCTTCGGCACCCTCGATGGAGCAAATGATGGCGCAGATACTTCAGATGATGTCGATGCAGCAGCGGTCCTTGATGGCG
AGCCATCAGCAGATTCCGAGAACGTTCCTTAACAACCAACAGTAGATGCACGAGTTTATGGTGCAGAAGGTGGCCAACCAGCAAAAGTAGCGTGCGAACC
CATCTAAGATCCTTGGCAAGCAGGATGAGGACTCGGAGTTGTAGGTTGAAGAGCATTTAGTTGCCTGCACCACTGAACGCGAAGCCGACGACTCGCGGTC
CGTTAACATGATGGCCGCCTTTCTTGGTCCCGACGTAATGTCGTGGTACCGAGAATGTAAAGCTTCGGTGAGTGAGGCATGGTCCTTGTTCAAAGAGCAC
AGTCGAGCACGGCTCAGGGACAGCGACTTTGAGTACAAGCTACTCACGAATCGCGAGTTACGGGGTCGTAGCACGAGTAAACGTCGCAGACGTTCATCGA
GATTCCCGGTATCACCAAACGTTGGTTTTACCAGCAGAACATCCGGGCCGACACAAACTCCTACATCCGCCGAAATTTCCCCGTGAGCCAGCAAGACACG
ATTGAGCATGTGCAGCTTCAAAGATACCCGCAAGCCAAATCTAACTCGCCCGTCAGCAGGAGTGCCAAGCGCTACTGCCAGATGGCCAGGACAGTCACCA
GCAGCCAGGACGCGGCCGCAGCGCAGATGGGTCTCCACAAGCCAGGCCAGCACCGCCCAGCGGCTTCAAGGGCCAGAAGTCACCAGACCGTTCGACGAAA
GGGAACTGGCGCAAAAAAACTAGGCTTCTCAGGGGGCTGGTGCCCCGCCGATAAAGGCTGCACTACCGAGAACCATACGGCAGAACCGCAGTCACTCTCT
GCGACTCAGCATTCCTTCGCCTATGAGCGCGATGATGCATTGCTGAGTCGTCAGGAAAAAAGCTTTATTGTTACCTGGAGCAGCTCGTGTCCACGAGTGG
CACCACTGCCTCTGCTTTTATCGGTTGCGGAGCACCTTTCAACGCTATCACACCAGCACTGGCGGAGAAGCTCAACCTCAAGATCCAGGAGCACAAGCAT
CCGTTGAAGCTAAGGCAGGGAGCAGGCGGCGTCTCGTTTGTTCCTCAACGCACTTGCACGCTGTCCGCATAACTACCTGGATTCCCGCGCTATGGCGTCC
TGAAGGTGCCAGAGACTCAAGATTTACTGCTGGGAATGCCTTCGTTAGTCGAGGCCAATCCTCTAATCGACTGGTCAAAGCGAGTAATTTCACCAAGGTC
CTCACCGAAGGGTGATCAACGAGCCAAGTCACCGCCTGGGCTGGCCCGTCCTGCGCAACAGGCATTACCATTCAAGCCGTGCGTGCCGCGGCAGAGAGCT
CGTCTCATTGCTGGTCAGCGCTCCTTGCGAATTCAATACCATTCTGAGGATCTCGCGCCCTTACAAGTCTACCTACGGCACGGCCACGACGGTAATCAAG
ATCGGGCCCAAATTGTTCGGAGTCGTGACATCCCCAAGCTGTTGGGCGAGGAAGTTCGCGAGTTATGTCTTTTTATTTCGTCAGATACAGCAAGTTCCAA
GACTGACGACACATGACAAACTCGCCTATT