Description :
From Genome Similarity Track
Location :
Scaffold_311:9712- 21259
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_311-snap-gene-0.10Flagellar protein
Pytiw_DAOMBR242034maker-piw_contig_311-snap-gene-0.1650S ribosomal protein L13
Pytiw_DAOMBR242034maker-piw_contig_311-snap-gene-0.11Gene of unknown function
Pytiw_DAOMBR242034maker-piw_contig_311-fgenesh-gene-0.3DUF1168 domain protein
Pytiw_DAOMBR242034maker-piw_contig_311-snap-gene-0.17Dynein heavy chain

Sequence
11547 bases(100 bases per row)
ATGTCGGAACTGCTGCTCTTCTGGCTCAACCACGAGCTGCGGCTCTCGGCCTTCGTGACTGACGTCGAGCACGACTTTGCGAGCGGCTACCTGCTGGGCG
AGATCCTCTGGCAGCTCAACCAGCAGCACAACTTCTCCGACTTCATGAACAGCAGCGTCGCGGACGCCAAGATCGTTAACTTTTGCCTGCTCGAGCCCAG
TCTGCGCAACATGGGCGTCAAGTTCGACTCGACGGCCGCCACGGCCATCATGAACGGCGTGCACGGCGCGGCCGCCAGTCTTTTGTACCAGATCAAGGTA
CTGTGGGTCTACTATGGATGTGTGTGGCTAAGCTGATCACTAAGAGTGAGACTTTGCGTGTATTTGGTGTGCGTAGATGACCGCAGCGAGGACCGGCCGA
GCCCCGGACGTATCGACAAAGTCACTCGAGCGCAAGTCCATCCTGCCGCTGCACAACATGCCAGTCAAGCTCGCCAAGCCCTCGTACGACGCAAGCAATC
ACCAGTTCTTTGAGCACTCGATTCGGCGGCGCGTCAGGTCGCTCGCTGCGCTCAAGCGGGAAAAGTAAAAGTCCATTTGTTACAGTGCCATCATCAGACT
CAAGGCCATGGCTAATTCCTTCTGACGGCGTGTGTGTGACAGAGAGGAGATTGCAGAAGAGGCCCAGAAGAAGCAGGCGTACTTGCGGAGCCAGGAGGAA
CTCAGAGAGCAGCTGGAGCTCACCAAGGCCGAGCGATTGCACCGCGCGTTCATCCACAGCCACTTCATCAAAGAGGCGCTCGAGGAGACTGATTCGCCAG
CGTGGCGCGTCGCGCTCGAGCGCAAAAGCGAGCGCGAGCAGCGCAAGGCACGCTTCTACCAGCAGCTGCTGGCGCATCAGAACAAGCAGCAGGTTTGTAC
TGCTAGTGTGGATCCATTTCGAATTGCTGCGGGTCGAAATGGTGATCTGAACGGTGGATTTATCTGTTTGTCTAGGAGGAGAACACGTTCAGTCTGCGGC
AGACTGTGAAAGACGATCTGGACGAGTTCGAGGTATATATAATCTGTATCGTTGTGTAGCTGCATATGGCTAACTAATACGTTCACTTCTTGGTTGTGTT
CAGACCAGGCGTGTGTCCAAGGGCTCGCATTCGAAAGACGCAACACTGCCGTCCCAGAAATCCGTTGGCTACGGGCTTCGCTCACTCAGTAGCACGCTGG
ACAAAGCCGACAGCGTCCAGGCAGCTCCGTTGATCTCTTCGTCGTCTCGCCAGGTGTCTGAGCGGGCAGGAGACACTGGAGTGGAGCTGTTGACCAACCT
CAATGCGATCAAAGAACAAAAACAGCGGCGCGAGAAGCGCAAAGAGACGCTCGAGCGGCGACGCAAGCGGTTCGTACAAGAATGCGGCTACTACCACTCG
AATTTGAGTGCAATCCGAGCCACGACAGCGCTCGAAGCGCTCGTGGCGCGAGAGACCAATAGCGAGAACGGCGTCCGTAAGGACATTGAGAACGTGATTT
TGTACAAGGAGATCGCACGAGAGAATAGAGAGCAGCGCTGTGTCGAGTACGAGAAGCAGCGGCGCGATGATGGCGAGACTGCGATTGACCGAGACGCGAG
TTGCTATGAAAAATTGGTGCTGCGGTACGAGGACGACGGCGAAATGCAGCTATTGCAGAAAACGCACTTGGAGACTGCAACCCAAGCAGCGAAGCGTCAT
GAGAACGAGCTCATTGCCTCAGGTGTCGTACTAGAACTGGTCGATTTTGCCATGTTTGCTGCGGGGAAGCGCGAAGAAATGCTCTTTGAGCGGACCCCGA
TGCTCTTCTTGCCAGAGGAGACGTGGACCGAGTACAAAGTGCAGTTTGTGCATGGCTGTGGGTTCATCGAGAGCAACAATGCTGGGGACACTGCTTCCAG
TCACCTCCTGAGCAAGTACCAGCTGGAGCAGTACCTGGCGTCGTTCCTCCCGTTTCTCCAGCATGCCGACTACGTTGGGTCTTCGGCAAAGGGCACTACG
CTCTCGCCGTGGTGTCCGTGTGATGCAAAGTTCGTTGGCGCTGTGGATGTTCTCGAAGGCCGCTTCGCGCTCGGTGAAGAAGTCAAGTACGTGCGCTGGA
TCAACCACACAATGGCTGTATCATCATCAGTACCAGCGCCTGTAGAGCTAGCTGAGGACCAGAGCGAGGCTGAATGCTTACCAGAGGCTGTTGCTTCCGA
AGAGAAGCCAGTAGACCTTGCTGGCGAGGAGACACAGGAAAAGAACACTACTGGGATAGATCCTGAATCACCAGTCGACGCGCTCAATGCTGCAGTTGTG
CCTGTGGACAAGCCGATTGTCGCCGTTCTTCCGCCAAAACTGCTTAGCATCCTGGTCTTTGGCTCGCCGTTCGCTGGAAAGAAAACCCACACACTGCGCA
TCGCGGAGCAGTACAACCTAGAAGTGTTCTCTGTGCACCAGTTGTTAGAGCAGGCGATCCAGAACGAGAGCGAGCTTGGTGCCGAAGCGCAACTGCTGCT
CTCGAGTGGTGGTGAGATGCCGTCGCGAATCTACAGTCAGCTGGTCCTAGAGGCGGTTCGCATGCTGGTAGTCTCTATAACAGCATCAATTGGCGATGAG
CAGGACGAAGGAGACCCAACGCCCACACGAAAGAAAGGCTGGATTGTGTACGATTTACCCGGGACCGCCGAACAAGGTCAGAATTTTGAACAGCTCCTCA
CCGGGTTCGTGGACCCGGCGCTGATCCCGTCACCATTTGACTTTGAGGCTGTCATCGCACCCGGGTGCGCAAAGCCAGCGCTGCCATCAAAGTTCCTCTA
CAGCAAGTCGGGGGTCGACCTTGTCTTCTACTTGGACTGCTCGTGTGACTGTGTCATGGAGAGGTGTCTGGGTCAACTGGAGGACGAGGCTACGCACGAG
CAGTTCCACCTTGCGTACAACTCTCCACCGCACGAGTCGACAGAGAGACACCGACTGACGCACACGAACACGAGCCTGAACTGCAGCGAATTGCTGTCGC
TCCAGTGTCTCTCAGTGGACGGTTTTGCCCAGTCGCAGAAGCCCTGGTACGAGAAATTCAATACGCTGCGAGAGATGAACACTTCACAGTCGTCGAATGC
CGAGGAGACCCACGAGCGCATGGTCGCGTGCGTCGAGGCATTTTACAGCCAGCAAGAGGACCAAAAGCTCGCGGAGCAGCAGGAGCGAGAAGCCAGTGAG
CTCGAGCTCATGATCACGGATGAGCAGCGCCAAGTCCGCATCTTGGGGCTCGAAAGCGCCATTGAGAGTGCGCATGAGGAGCATACACGCTGCCAGCAAG
CGCTCCAGCAGGCCGAGGAGACCAAGGCTAAGAAGGAGGAGCTCGCTGAGCATCGTCAGGCGCTTGAGGCGGCTCAGAAACAGGTCGACGCCGCGATCTC
TAACGCCAAAGAGGCGATGTACGACGAGATCCAACTCGCTGAGCGGGCTGCGCAGGTGTTTTCAGGGAAACTGTTGCCGCAGCTGAGCTCTCTGCTGGCG
AATGTGTGGACCGACATGGAGAGTGAGTACGTATCGATGATGCTGCGCGCGTTTCGCTTGCAACGGGAGCAGCGGCGACGCGCCTCAGACCGCTCTAAAC
TCGTAATTAACGAGTTCTGCGGCTTTCTGCGCCGACCGGACGCCAAGCAGAGCTTCGTGAACGCCTTCCAGGAGAAATTCAACCTCGTGATCGACGAAAT
GCGCTTTGACGAGGCGACGAAGCTCGAGTTACACGCCCGTACGGACATTCTTCAGGACGAACTGACGCTGATTATAGAGACCAAGACGGCAGAAAACGTC
GAGGAGCTCAGTAGTGTCACGAAGGACGGTTGGCTCGAAGACACGTGCATGAGTGTGGCGATCGTGTTCCAAGCCGCGCTCCAGAGCGAGTGCGACCGCT
TCCTCATCTCCTTCCAGGTACTCGTGGAGGGCTACGCCGCTGCAAGCAGCTCACCTACGCTGCTGGCGCCGGCGATAGAGAACCTTAGGCTGAACCAGGG
ACTGCAGGACCTCTGCTGTCGACTCTTCTACGATGCCTCGGTCATTGAAGAAACCACTCCAGTGGGAGCAGTGGCGACGACACCAGCGCCTGCTGCTGTA
CCTGCTGGGAAAGGAGGTGCTGCGGCAGCCAAGGGCAAAGGGAAAGCGGCAGCAGCGTCGACGCCAGTTGTGACAGCTGTCGTTGCTGTGGATCCCATGA
AAGAGAGCCTGAATGGTGGCGACCCCATGGCCATGGAGGACCTCTTGGCGTCCTATGACCGCGCGCTCCTGAAATGCGACGCGATTGTCCAGTTGGTGAC
GTCCAAGGTAGCCGGCAATGTTGGTGTCGAGCTTGAAAATGGTGGTAGCAGCCCTCCAACAGCAGCTCTTGCATCGGGTCCTTCGACTGGCACGTTTGAC
GTCTGTGTGGTCAATCTGCTGAAGGGCATCAAGTACGAGCACGAGCTGGTCCAGCGTCGCATCAAGTACCTGCGTGACGCAGCCCAGAGTGCCTGTGAAC
AGGTGATGCGGTCCATGCGCGCGGTTGAACTGACGCTTCAGGACGTGATTGACGAGCGGCGCGACCGGGAGCAGGCGGCCGTGGCGGCGCTCGTCAAGTA
CATCCGCACGGCGATCGAGGCAGAGGTGGATCTCCCACTGTTTATCAACGCCAAGGTAGGTTGGATGGCGATTTTGTGTTTGGTGACTTGAGTTGCACCA
CTACTAACCTCGTAGTATGTGTACGTTTACAGCCTGAGATCCTCTATCGGTTCCCAATCACGGTGCAGCTCCGAGAAGACTCGCTCATTGATGTCGATCC
GCTCAGTCGCCTGGTTGAGCGAGCGGCTGTGGACCCGCCACCGAGTGTCGAAGAGGTTCACGACGTGCTGCTGAACGCCAGGCAGTGCCAGGGGCTCCTG
GGGTTGCTGCAGCCGTCCTGTTGTTCGTTGAACTCTGATGATGAGAATGGAGATGCTAGTGCTCAGCTGGTGATGCCGGTGAGTCTACTGGTGGACATCT
TGAGCAGCGTCACGTCGACACCACTGCTGCCACGGAACTGGAGCAAATGCCAGCCACACATCTTCGCCAAGGTGCGTGTATTTCGAATGGAGTGATGCTG
TGAGACGGGTTGTTTGTGTACTGACACGTGGGGTTACCTTTTGTGTGCAGATTGGCAGCCACTTCCTGATACAGAGCGATAATTCCACAGCGACGGGAAT
TGTTGATGTGAACGCGTTCCTTACAGCACTCTGTGGGGACAAGGTGCTGCTCCGTCAAGCCATGGACGAGCAACAACGACAGTAGCAGGAGGAGGATGTC
GTAGAAGAAGACGATGGGTCTGAATTGAGCCTAGATATAGCGATTGACGAGTGATATAACGATAGAGACGCATACGGCCAACGTTAGAAGACAAACAGTT
GCGTGCGTGTATTGGTTGTAGTGAACTGATTCTCTTTTTCCATCCCTGCATAAATCGCTCCATGCAGGAACAAGCCCACGGGCTCTGTCGCTCTCGCCTG
TGTGTGTGTCTACAGCACGACTGGGTTATCGCCGAGCTGCTCGGCGAACTCGTGCTCCTCGCCCATGAAGATCTTGAGCTTCTTGTCCTGCAGCGCGCGC
ATGCGGTTCTTGGGCAGCATGCCGAACACGGCCTTGCGCAGCACCTCCTCGGGCTTGCGCTCGAAGAGCTCCTTGGCCGAGCGCTGCTTCAGTCCGCCCG
GGTGGCCCGTGTGCCAGCGATATAATTTGTTGTTCCACTTGTTGCCCGTGAGCACGATATCCTGCGCGTTGATCACGACCACGTAGTCGCCGCAGTCGAC
GTTCGGCGCGTACGTCGGCTTGTGTTTGCCGCGCAGGATCGGCGCGAGCTGCGACGCGAGTCGGCCCAGCACCTGTCCCTTGGCGTCCACCACGTGCCAC
GCCACCTTGGACGCGTTCGCGATCTTGCTCATGCTCTCGGTCTCGCGGTCTCTCTCTCGGACGGAGCTGCTCGCGCTTCCTTGTTGCGCGCCGTAAGCTC
GACTTGGGAAAATGGGCATGCCAAGCCAACCAAACAATACGTACCGGTTTGGTATCGGTATACCGAAAACGTTTGGCTCAAACTTATATGCCATATAAAT
ATACTTTATGTTCATGTCGGTTCGCATACCGGTATATAACTCATTCTACATATCATTATTATAGCTCATTATAGCTCGCTCATTCTGGCGACCAAAAAGC
AAGGAGCGAAGTAAGCAAGCATGGGGCGATATACGACCGTGCAGACGTTCACGGACCAGGACGCGAAGGCCGCGATCTCGTACTCGACCGCGACCACGAG
CAGCAAAGCCACGAGCCACTACGGTCCTGGAGACACGAGCAGCACGGCCAATAGCAGCAGTGGCGGTGGCAATGGCAGTGGCGCAGACAAGCACGGCGAG
CCGAAAGTGGCGGTCAACCGCGTCGACAATGTGTCGGGCAGCTCTGCTGGCGCCGGCAGCGGCGATTTCCACATGTACCGCGCTGCGAGAAGACGGTGCG
TGGGTCGCTAACGCGTACTACATCACTGGTGTCGCTATTGACTGTAGTTGTGTATTATGACTGTTGATGCAAATAGCGAGCTGGACCGCGTGGAGCGCAT
GGAGAGTGCGTACGCGCAGAAGAAAGTCCAGGAGGAGTTTGAGCGTAAGCGCGTGGCTTCCATGAGCGAGTTCGAGGCGCGCGCCCACAAACGCGCCGAG
AAGCGGCGCCGCCGCAAGGAGCGCACCAAGGCGCGGTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGAGGAATCAAAAAGCGACAAGCAGCAGCCAGTGAACAAGAAGCAGAAAGTCACGAAT
GAAGCTGTGTCTGTGGGCTTGAAGCCGGCGGAGGCGCTCCCAGAGACTCCTGGTGGCGTGCCGGAGATCGCAAATGATGGCAGCTTCCTCGCGCGAATGC
TCGCTGAGCAGCAGAAGAAGGCGCCTGTGAAGCACGAAGATAGCGAATGAGGTGGGTGAATAGCCAATTCGAGTGCTGAAGACTGTCGTGTTGTTTGGTT
CGCTAAACTGGCGTCACGAGTCTGCCTTCGCAACATACATAACATAGCAAGTGTATCAAATCGCGATGCTGGTGGGTATGTTTGTATACGCAAAGACTGT
CAACTACTGGATGAAACTCACTCACAAGGCCTAGTTGTCGTCCTGGAAGAGGATCGCGACGCCGCGCAGCACCCACTTCTCGCCGCCGCAGTCCGTGGGC
AGCGTCGCGAGGAAGATGTACGTGTGGCCGCGGAAGCGCGTGAGGTAGACGGGGCACTCGTACACGAGCGGGTCGTGGCGCAGGTACCCGACGGCCGACG
GCTCCCAGCTCGGCTGCGTCTGAACGGCCTTGACGTACACGACCGGCAGGAACCAGAGCAGCTCCTTCGGGTTGCTGTCCAGCAGCGTGCCGCCGCACTC
GGTGGACGGCGCACTGCCAACCTGGTACCGCTCCGAGATCTCGTCCAGCGTGCTCCAGCGCGCGCCCTCGAGAATGAGGCCATGCGCAAAGACGCCATCA
TCTGGGTAGTACGTCGCCTGGGCCGCGTCCTGGAACGTCGTCACGTGGGTCTCGACCGTCATCTGGTTGAGCGGCATGAACTTCTTGCGCGACGTCACCT
GCAAGCACGCGGTCGTGTACGCCGTCGGGTTGAAGAGCCCGGGCAGCCAGATCGAGAAGGGTGTGACAAAGTCCGTGGACCAGAGCTGCATCTGCTGGTA
GCGCTTGACCATATCGGTGAACCAGCCGCTGAGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCTCCCATCGGCACTGCGAGAACGGGTTGCGTCCCGGCACTTCGTTGAGCGACATGGCCGTCGCAAGGT
CCTCCATGGCCTGCGACATATTGAGCTGCCCGTTCAGTCCCTTCTTGAGGTCGCCCAGGGAGATGCGGATCTCTTCAAGCAGCACGTTCATGCGGCTGCA
CTCCTGGAGCGCCACGACCACGAACGGTCCGTGCTCCTCGGTCAGCAGAGGTGCCGCCATCTCCGTCAGGTCTAGCATGCCGAAGAACTCGGGACAGCGC
GCCTCAAACTCGTCGATCATGTGGCGTAGCACCGTGGTCTTGTCTCCACCACTCTCGCCACCGCCGCCAGCGCCTCCGCCGATCGTCACGATGGTGTAGC
AGAGCGTCTCGCACATGGTCGTGAGGTACCCGATCTCAGCGTTCGGATGCAGGCCGAAGAGCGGCGGCGCCTCGGGCACCATGTTCTTCTCGATATAATT
GGCGTACTCGGCGAAGTTGAAGTCCTCCGGGTTGGGCGACTTGAAGCCCGGTCCGAGCTCCATGCCGTTGAGCAGCCCCGGGTTGATGAGCACGGTCAAG
TACGTGTTGTTCGTCCGACGGTCCCACGAGTCCGTGATGTGACCGCCGTACATGATCTCACCAAAGATGTACCGCAGGTCGTCCCAGGGCACGCTTGGGT
TGTTGTCCAGGTACGAGTGCAAGATATTGGCGCATATCGTGAGGTCACCAGTGTTGAAGCTGTACGCGCGACTCCACCCTTGCTGGCCGAACCGCTTGCG
TCCAAGTACGATCGCATGGAACCAGCAGAGCGCAAAGAGACATGCCTTGAAGTCCCCGGGTTTCGTACACGCCTGGATCTTGTCCTCGCTGAAGTTGGCC
CAGGCGCGGCGCAGGTTCGACTGGATGTCGGACGGCGCCTCGTTCGCCACTTTGATGCAGCTCTGCATGAGCGACTCGGGGATGTTGAGCATGTCCGGCA
GCGGTGGTGGCTCGGCCGAGATGAAGCACCGGAAGTTATCGTGCGCACCCTCGGTCGCCACTTCTTCCAGCTGGCGCTCGAGCGTCGGCAGCCACGACTG
CATCAGGTGCACGTTCTGAAGAATGATCCAGCCGCCACCAGCGCTCAGCTTCTTGAGCGACTCGCCGGCGTATGACTCCTGGCCCTGGCCCATGGAGATG
TTGATAAAGTTCGCGTTCTCAATGTTCACTCCGTTCGCGCGGCCGAGTTTCTCAACCCAGGGCGTCGGGTCGACACCCGGGAAGAGCACGAAGAAGATTG
GGATCGACGAGTTCGTCTCGGCGTACGTCGAGTCCATGTTGAACGGCGGCTGGGTCACGTACTCCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCCAAGATAAACGTGCGCAGCGCATTCGTGACGCGATCAGGGCGC
AACGCACGCAGCAGGATCATGCGCTGAAAGGACGTGAGTTTGATAAAGTCGCCCGGCAGCTTCTGACGCTCGGCGTCCTCAGTCGCAAACCATTTACGCC
ACTCATCGGGGTCGTTCTGGATCGCATCGCCGAGTCCCTGGAAGCACTTGAGCCCTTCAAGTGCCTTGATCTTGGCCCACAGCGCAGCGAGGAGCCACTC
AGATGCTGAGCCAGCATTGCCAGCGTCTGGGTGGGACTTGCTGATGAGCAAATACTCGACCTCCGTGTCGGTGAGCAAAGCGTCCTTGAGCAGGATCTTG
AGCGTGAGCATGGACGCGACCGTGAGCTTATCGCGCTCAAAGAGCCCACGCCGCACGTAGTTGTACACGCATGACGTGATGCTATCCATGAGAATGCGGC
AGCGCACATGCATCTCTTCGTCTGTGAGCTCTGGGACTTCACTGTCTTCTCCTCCACCTCCGCCAGCAGCAGCAGCAGCATCTTCTCCTTCGCCACCAGC
AGCTGCTGCGTCGCTCTCGAGTTTCTTCATGGGCACGCGGTAGATGCCCGAGAGGAACACCTGCTGGAAGGACGCGAGCGAGTAGATGTAGTACGAGTGC
ACCTTGCTGATGTCGTTCATGAGGAAGAAGAGCAGCGCGCCGCGTGCCGCGATGCTGCGGTACTTCTCGCTCGTGACATTCACGGACTCCTGGGTCTTCT
TGGCGGCCTCCATGTTGTTCTGCGTCAGCTGCGCCTTGTACTTGGTGTCGCTCAGAATGCTGATGAGCGGCTGGTTGTTCGTGATGTCGTCGTCGGCGCT
CGCAAGGTAGAACAAAATATCGTCCTCGAGCTTCTTGAGCTCGATCTTGCCGTTGTTCTGCTCCTGGATGAGCGTCTCGCGCTTAACGGCCAAATCATTG
CGCTCCTTCGACACGACTAGATTGAGCAGCTGGTCTTCGAGGCCGAGGATCGTGACCGTGAAGTTCACGATCGTGCACTCCGCCTGGATCTCAGGCGGGT
AGTGCGGGTTCCCGAGCTTCGTGTGCAGGTACAAGTGGAAATTGTCGTTGTACGGCACCGAGGCGTCGCCGATCTGGATCTCGTAGCGAGCACCGCGCCG
CGAGGTGGACCGCTGGATCACCGGCGCCAGGATCGGGTCGATCTTCTCGCCCAAGTTCTCGATCATGAAGGCGCCGTCCGTGCCGATGGCCGACTTGAGC
CGCTCGATCCACATCTTCTGGCCCACGCGCACGATGATGAGGTTGTTGTGTACCTCCATTTCGCGGATCCACGCGATGGCCTGCAGCTGTGGGTCGATGA
TGAGCGGCCGGCGGCCCATGGTCACGGTCGTCACGACGATGGCGCCGTTCTCGGTCGAGACGCGGTCCGACGGCAGCTTTTGCGTGTTCCACTGCGCGAT
CTGTGCGTCGTCTGTGAGGATCGTGAGCGGATTGGACTCCTCCGACATGGCGATGCTCTCGCCGTTCGCGGCCTTGCGCAGGAACGGCACCCAGTGTTTG
TTGATGAGCTCGTCGCGGAACGGCTTGGTGAACGGACCGATGTACGAGATGAACGCGGACGCGAGCAGCACGTCGCCCACGAGCAGATCCTTCTCTTTCT
GGAGCTGTAGCACGTTGATGCCCCAGCGCACGTTCTCGCTCGAGAGGTCGTTCGTGAGCGTGCCAGCGAGCTTCATCTTGCGGTTGCCCTGCTCGACCGA
GTTGATCGCGTCCTCTTTCTCCTTCTCGGCGGCCGCGGCCTCTTCGAGCAGTTTGTCGAGCTTGGCCTGGAGCTCAGCGACGAGCGTCGTGACTTCCAGG
AGGCGCTTGTTCGCGGACTCGAGCTCGAGATTGGCTGCCGCAAGCGC