Description :
From Genome Similarity Track
Location :
scaffold_19:9710- 12773
Transcript NameFunction/comments
g1051.t1hypothetical protein
g1052.t1 hypothetical protein PHYSODRAFT_314719

Sequence
3063 bases(100 bases per row)
CGTGTCCTTCCGCGTGCCCTTGCCGCTGCGGCCTCACAGCCCCGTGCTGTAGTGCCAACTCTTCAGCGTGGCTGGATGAAAGGTGCGCTTACTTCAACTC
TCCTGCGATCCTGGAGTTGTTGACGCAAACAGTTCGATGTTGTCTTGCAGTGCCCCGCAACGCCAATGCAATGCAGTGGCGCCAGTTCTCTAGCGTAACG
GAATCGCACGTTCATGACGATCACTCGTCCATCACGCAACAGGTGCTCAAGTATCGAACTGCATGTGAACGGGAAGGAGACTGATGTTCGGCAATGTGCA
GCTTCTTGGAGTCGATGTACAGGATCGTGAGTTCATCACGCTGCGCTGGCAAGATGGCAAGAGGAGCAAGTTCCACCTGTTGCATCTGCGCACGTGGTGC
CCGTGCCCGGAGTGCGGCCACCCGACGGGACAACGAGTTGTGAATTGCGCTGAGATTGACCAGGACGAGCTGGACATTGAAAAAGTCTTTGGTATGTGTT
GCGTACGGGATACTGCTATATTCGTTTGTGCTGATGAAGGACTTTGTGGGTGGGTGTAGTCAAGGGGGATACGTTGAACATCGTGTGGAACAATCGCCAC
GAGTCCAGCTTTGAATGCAAGTGGCTGCTCGAAAACAGCTACGCAGACTGGGCGTTAAACCAGCATGCCCATGATATGACCACGACTCCGCTAGCTCTTG
ACGCACCTGTTCCTTCAACCGAGTATGCTCGTATGATGGATACGAGTGATGACGAGGGTCTGTACGAGGCGCTTCGACAGGTTGTGGAGAATGGCTTCAC
TGTCATTTCCAACACTCCTTCGGTTCCAGGTGCGGTCAAGACGCTTGCAGAGCGCATTGCACCCGTCTCACACTCGTTCCAATACGGTGACGTCTTCGAT
GTGGTGGCGGAGCCAAAGCCGGTAAGCTATTAAACACACAGGTACTCGCAATAATTCGCTTCTGACTGTATGCGTGTGGTGTGCTTCTAGGTCAACATCG
CCTACACTACTGTTTACTTAAAAAGCCACGTGGATCTGGCGTACTATGAGTCTCCTCCTGGTTTCCAGTTCTTACACGCGTTGCGCTTCGACGAGTCTGT
CAAGGGTGGGGAGTCAACGTTTGTGGATGTCTTCGCAGTTGCGGAAGAGTTCCGTCGCCTTCACCCCGAGCACTTCGCTACTTTCTGCCGCGTGCCCGCG
ACGTTCAAGAAGCACCACCTCACCCGAGATAAGGCAACAATAATGGAGTACCAGCGTCCTCACATCCAGCTGAACCACCGCGACGAGGTGGTTGCTGTGC
ACTGGAGTCCTCCATTCGAGGGTCCGTTGAGAGTTCCATTCGATGATGTTATGCCGTACTACGACGCCTACCGTGTCTTCCACGAACTCGTCGAAGGCGG
CTCGCATCGCTACGAGTTCAGGTTGAAGCAGGGAGACACTGTGATCTTCAACCAGCGCCGCGTCCTACACGGTAGGAAGCAGTTCACGCCGTGCTCGGAC
GGTGTGCGCCACCTTCAGGGCACTTACGTCAACATCGATGACGCGCTGTGCCGCTACAACGTGCTGCGCACACGTTTCGGCTCCGACGACCCCACCGCAA
AGAACCAGCGCGTTTCCAACGGGAATTTCTCGTAGAGTTCACTCATATTCGTCGGCAACTTCAGGATTGTTTAAAGTTGATGTTGGACTCAGATCTGATC
GCATATCTGAATACGAACTGATTCCATTGTGTGTCAATTGTGTAACGTGAAGCACTTTGCGAACACACAATGACGCCCACGCTATTGCTGCGTCTTCTGT
GTCTGTGCGCCGCCTTGGGGGCGTATCTGTGCTCCAGTGGGTTGCTACGCCTTAACGAGGTGTTCTTCCAGAGCGCAGTCGCCTCTTCATCCGACTGGGA
TGACCATAATGCTCTCCTGAATGGCCAGCAGAAGGGTGAAGCTGCTTACGACCGTCTCGTCGTCGTGTTGATCGACGCTCTGCGAGCTGACATGGTGCTA
GGCAGTGCGGCAATGCATGGCAATGAAGAGCGTGATAATCAAGCGTTGAAGGGGGAGCTGAACGCTCATATGCCGTTCACTAGCAGCCTTGTAACGTCGG
GGAGAGCTCTGGGATATGTAGCACACGCCAGTGTCCCGACAGTGACAATGCCTCGCCTGAAGGCGCTCGTGACTGGCAAAGCTCCAGCTTTTATTGACAT
TCTGAAGAATTTTAACTCGGCAGCTTTGGATGGAGATGCGAATTTAGTATCGCTATTGGCGGCAAGCGGCAAGAGAATTGTTTTTTATGGTGATGACACG
TGGCTCAAGCTGTTTCCGGAGTCGTTCAAGCGCTCCGACGGCACGTCGGGCTTTTATACGAGAGATACTGTGGAAGTGGATACGAATGTGACTCGGCATT
TAAGTGAAGAACTAGACCCGAGCATGCAGAACGAGAAGAGTGGAGATTGGGACGCGTTGGTGTTACACTATTTGGGATTGGATCATGTCGGGCATCTACG
CGGGCCTAGGTCTCCCTTAATGAAGGACAAACTGCACGAGATGGATGATGTTGTGAAGTTGGTTGTGGATTCTGTACGAGAGCAAGACGCACAAAGGATG
AAGAATGACGACGCAGCGCGACCGTCGTTGATCTTGGTTTGCAGCGATCATGGTATGTCGGAAGTTGGCAACCACGGTGGCGCCACATTGGAAGAATCAT
CAGCGTTGCTGATGTTCATGCGTGGAGATGGCAACCCGATGCACGCTTCAGCCGGAGTTTCGTACAAGCAGAAGCGCAACCAGGTGGACTTGGTGCCAAC
AATCTCTTCACTATTCGGTCTCTCCATTCCACTCTATAGTACGGGCTTGATGCTGGAAGATGTTGTCCGTGCTTCTTCTGGCTCTACGTCCCGTGGTGAC
GTTTACTATTTGCGTGCTTTATTCCGCAACTTCCAACAACTACATGCCCTTGCCAGGATTAAGTTCCATGACTCGGAATTAGCGAACTTCGACGAGAAGT
TTAAAGAGCCACTGAATAAGCTTCGAGAAAGTATTCAGCGGAGTGGAGATGGATACGCTATTG