Description :
From Genome Similarity Track
Location :
Scaffold_719:971- 2282
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_719-fgenesh-gene-0.0Glucose transporter

Sequence
1311 bases(100 bases per row)
GGGGCGATCGTGCAAGCCAGCGCGTCCAGCGTTACCGTGTTTGTGATTGGCCGTACCATCTCTGGACTCGCGTCGGGCGTTGCGACCGCCATGCCGAATG
GCTACATCAGCGAGATCGCACCGCCGCATATTCGCACCAAGCTCGGCGTCGGCTTTCAGCTTGCCATGGCCACGAGTCTCATCCTCGTCTCCACGGCGTT
TTTCTTTGCCAACACGGCCAGCGGCTGGCGATACATTGCCGGTTTCCCCGCTGTCTTGGCGCTAATCTTTGCTGTCGCTGCTCCCAAATGCATGGTCGAG
AGTCCGACGTGGCTGCTCGGCAAGGGCCGCCAAGCGGACGCTGAGCGAGAGATCGCCAAGCTCTTTGGTCACGAGAACGTTGGGCTCGCCCTCTCGTGGA
TGCAGCCACAAAGGACTGGCACTCCTACGACCACCAAGATGCAGCAGGCCGATGCCGACGCGGTCGAGGTCTCGCCCTCATCATCAACGATCGTCGAGAA
CCCGTGGAAGGCGCTGTTTTCGCCCGCGTACCGCCAGCAGACAATGCTGGCCATCATGATGACGTTCGCAATGCAGTTCTCTGGCATCAACGCTGTCTTC
ATGTACTCGTCGTCCATGTTCAGTGAAGCCGGCGTCTCGGACGGTCGCGTCGGCACCATCATTGTCAATACGGTCAACCTCCTGCCGTCGTTTGGCGCAG
GCTGGCTAGCGTCCCGCTACGGCAACCGCTCGCTACTGCTCATGGGGCAGAGCCTCATGATCGCGTGTGCCGTTGGCCTGACCGTCGCACTGCTGGCCAA
CGTCCCGGAGCTGTCGATCGCGTTCATCGCGCTCTACGTTGCGGTGTTTGCCGTCACGCTCGGCTCGCTGGCGTTTGTTGTCGTGGCCGACGTGTTTCCC
GACGAGCTGCGTGCGAGCGGCGGGTCCGTCGCGCTCTTTGCCAACTGGGTCGGGACGCTCGTGATCGGCGTCGGGTACCCGTACGTCGCGGATGCACTCG
GTGATCTCGGTTTCTTGCCGTTCATTGCGGCGATGGCGTTCTTCACGCTCTTTATGTTCAAGTTCCTGCCCGAGACCTCACGGAAGACGAGCGACGAGAT
CCAGGCGCTGTTCCGCAAACGGGAGTAAAGCATGCCCACTTGTCAACGGCGTGCCGGAGCCATGGACACACACCCCGTTGTTGATGACTGTAAACAAAGT
TCTACTGAAGTGCTACGTAGTAGATGATAATACATGTGCAGAGTTATTGTAGAACACGCAAGCGAGGCTGCTATAGTCCTGAAGTTCTCGTGTTGTCCCT
CGGCCCGTGAA