Description :
From Genome Similarity Track
Location :
Scaffold_74:97093- 103665
Sequence
6572 bases(100 bases per row)
AGGTGATTGCTGTCTTAAGACGGGGGTGATGTAATGGGCCCTCCCAAGTTACATATGTAGGTAGTTTTATAGGTTCTTTGTAGTGGCGCACACCATTACA
TAAGTAGGTAGATTTGCATTAAAAAGTAGGTGCAGCAGCACGTAGCGTGTGCTGAACTTCCGTCACCCTATTGGTTGAAATATGGGGAGCCAGACCTATA
ATCAACCAATAAGGAGTTGACGTGTATTTGAGTGGTCAGGGCAAGCCGCCCTGGACCTAAATAAAAACAGAGTGGATTTTCCTTCAGACTAAGTACTTGG
TTTCAGTATCACTGGACTTGTACGCTTCCTCATCACTACGTGTAAGCAAGTAACGGACACCCCAGGCCCGTTACAGAAAGTTTGTGACGAACACTTCTTC
ATTCTGATTGGTCGGTAAACCGAACCTAAGTGGGGGAAGATGTAACGGGATACGTAGCACTAAGTGTACCCTGGTTACATGAAGTGTGGCACGTCACACC
TCAGAAGTATGACACGTCATACTTCGGGATATTTGGTACAAGGTACCAAGGTCGTCCAAAGACAACCACTGGTTGATGACATTGCATTTCTATAGGTGAC
TTATAGTTTGTAATGAACCCAAGCTTTATCTAGCTATAAATATACTCAGTTTACAATCGACCTTAAATAGGTCACTTCGCTCCCTTTCGGTGAAAGGGGG
CCTGTGAACTGCCGTTCACGGAGCGTTTCTATACTCTCGGAAGCCAACTTCCTCTAGTGCAAGGTGCTGTGTGACCCCGTCATACATACCCAGGCCGTCA
CCGGTGGTTGATATGACGGAAGCGTATCATGACGGGTACTAATTGTGAATTTGAAAATAAGATCGCCCGGCTGATGCCGGACGTTTACCTCACGTAACCC
TAAATTATTGCGCCTTTAATTGCAGACTCATGCCACTTTCTTTCCTTTTCACTACCGGTACACAGCTTACGCTAATTAGTCATACCCTGACTAATTGTGG
TGTACCGGTCGAAACCCTATATACTGGTATCTCAGTTTACATTCTACCTTAAATAGGTCACTTCGCTCTCTTTAGATAAAGAGGGGACCTGTGAACTGCC
GTTCACTGAGAGTTTGTATACTCTCGGAAGCTAACCTACATCCTCTAGCGCAATACCTATCAGCCTTTTGTAACGGGCCAGGTATTTACTCCGTTACTTG
CTTACACTATAGTGTTCAGGAAGCTCGCAATAGGACGACTAAGTCTTAGGTTTAAGGAAAATCAACTCTGACTTTATTTTAGGACCAAGGCCACAGCCCT
GGTCACTCAAATACACGTCATAGTCCAATTGGCTAATAATGGGTCTGGCTCCCCATATATCAGCCAATGACATGACAGAAATTCAGCACACGCTAGTCGT
GTGCTGATGCACCTACTTATGTAAAGAAATCTACCTACTTATGTAATTGAGGGGCGGTAAGACTACAGCTAATAAAAGGGTTTTTCGCGAAAGAAGTCAA
AGCAATGTGTCATTTCAACTTAGGATATGTTATTCGTATGCTGAACTCAACGTAGTACGTATTGAACATCTAGCGCGGGAGAGGTCTACCACGCGTATGC
CTCAAGGGTAGGGCCACCGTTCGTGTCGGGTAGAGCTGAGGGGTGATGTTCCACGTATCGTACTGGTAATTACCCGGAAGCTGCGTCTCCCATGTCTCGG
GTTTTACTCCCACCGCACCCGCACTTCAAATCTGGTTGGGGATGTAAGGATTTACCACAACACCCGAGGGATAGCGTATCGGACCGCAATTGAAATGATC
CGGGATAGCTAAGGGTAGTGCCGGTAAACCTCCCAGCAATGTCATCTGAGCCCGCTGTACATTGGCACCAAATACTTGATCCGACCCACCCTGATCTTGT
GCATTTCGTCGAATCCGATGATCTTTAAATTTTAGTTGGTATCCGTTGACGCCAGAAACGCTGAGACCGTACGCAGCGCGCCCGCAAATAATGTGCGCGC
AAGACAAAATCTTTTTATAGTAGTAGCAGGAGCACTGGTGGAGTCGATTCGCACCACCCACCCCTCTCTGGGCATAGCAACGTGGTGGGCCCGACGCACT
GACCACTTAACAGCAGTCCTGTAAAAGCTCGCCGCCTTTTGTTTTTCCTCATCTTGAAGGCACTCGGGGGAAAGTAACGACCCGAGACGCTCACCGCTCA
GAGGAATGTCGCCTGAAAGCGACGAGACGTCATTCGCCTCTGTAGGGATCTCTGGATCATTGCCCAGATATAAAACGCGTACCGCCGAAGGCGTGAGCGT
AGCGTAGATAGCCACTCGACACGTTGAGACCAATACTTTTGCCAATCGTGTAGGCTCCTTGGGCGGTGTAATTCGATCGCCCGCTACAGATGTGGGAAGG
CATATAGTGTAGTCGTCCGATATCGTCAGAAGTTTTTTTAGCAACCTCCTTGTGTCACACGCCTTGCGTTGTGTGTGACTCTTTATGCTTGCGTTGAAAA
CCTCACAGGGATTGTTCATAGTTGCAAAAGCCCCCGGCTAATGAAAAATCTGCCACCGCCAGAAGCGACTAGCGACCCATTGACTGTAGAAATAGTTCGT
GAAAGTTTCTAGTCTTCCGTCCAGAAGCCATTCCTGAGAAATGCGATTCCACTCCAGATAGCGATGGTCCCTGCTAAGCGTGTAGTGCATATCTAGAACT
CCGCGGTACACAACAGCTCCAAGGGCTTCGACAAGGTGCTGGATACGCTTTCGTACGTTGTATAGTACGTGGAAAAAGCACATCAGGTAAATGCTGTTCT
CAAACTCACTGATAGCAACTAGCCCATTAACCTGAGCCTTCTCCGCGTCTTCCATCACAGCATTGATACGCAGTGCTACACCCAACCGCTCCCAAATAAC
CCTGACGAAACTACGAACAGCCTCATAGTACTCACGCTCAGTTCGCTGGCTCACAATAAATATACTAGCTAGGTGGTAGATTCTTCGCCGGTCAGTAAAG
CCACAGGTAATAGCTGGATACCCCAGGTCACTGAGTTTGAAAGTTGCATCCAGGTGAAAAATCATAAAGTTCTCCTTCTGCTGTAGCGCCAGAATAGCTT
GCATGAGTTTCAGACTGGCTATACCCAAAAATAAAGGTTCATCGTCCTCGCCATTACCCACAATCAGGAATTCACTTTCGTCCTGTCGAATTTCAAAACC
GAACGCCGACTATGGGTCAAGATTGGCCCTGAATGCTTCGAAATGACCAGCTCGCGTGACTTGAGCATTGAGTTCTTCGACCCGTACAGAAATCGATTGT
AACGAACGTTTCGCTGGACCTGAGCGCATGATGGAAATCCAAGCGCTGGGGACGGAAGGTCCGGTGCTCGCAGAAGCTTACTCCATATTAAGCGTGGTGG
TATTGCGCTCTCATCCATGCGTTGGAAGTACTCCCGCATTTCAGGAGTAACGCGTGGGGGTGGCCCTACAGCACACGGCGTATCGCCTGGTAAATGCTTC
TCAGTGCTCTCGAGGACGACCCACGTCGACGAGATTTCGCAGTGTTGAACTTTCCAATGCACTACTCACTTCTTCGGCAACCCGATCCTGCGCAAGTCGG
ACTCTTACATTGCAGGCGGCGCTCGGCCATTTCGTGGACGCCTGCGCAAATGCTGCACCATTTTGTTCTCACTAAAAAAATGGTCGAGCAGCAAAAATGA
TCCCATCGGTACTTGACGAAGTCGGACTCGACATGCAGCTCGGCACGCTTGGTCCAGATGAGTTTGGGGGGAATCGTGCAGACGTTTGGGTGGTGGTCCG
GTAGGAGCGTATCTGACCCTTGAGGCTGAGGTTCAGAATTATTGGCCAGACGGAGTTGTAGAGACAAATTCAGCGTAAGCGGGCTTAAGGTTTTTTTATA
ATCCTACATATTTGGTCTTGAGCACAAATAAAAGTTGTGCTTATGTAACGGGGTACAATCCACTGTGCCCCAGGTTACATAAAGAGTGACCCGTCACTCT
TGTGGACACCTGGTAAACGGTACCAGGTGCTCTCGGAGCCAGTTAGAGCATGACTACTTCGCTCCACTATAGGTAACCTCTAGTTTGTATGGATTCCAAG
CTAACCTTATTTATAAATACATCAGTCTTAAATCTACTCTTCTAAGTAGCAAACCGTTCTCTTTGAGGCCGGGAACACGTGAACTAACGTTCACTCGGGT
AGTTAATATCCTTAAGCACTTCCTCTGTGCAAGGAGCTTTGTGACCCCGTAACACTTGGTAGCACTCGTAGTTAATCCAACCCCATCGCGGATAGATTGA
ACTACCTGAATCATCTGTGCGCTCAGCGTTTGAGCCACGATGGACCGAAGCGAGTTTCCTCGCTTGAACGACTCACAGTACGAGTCTGTTCGGAAGATGG
GAGGCATCTTTGGACAAGTTGTCCTTCGCAGCTTGGCGGCAACGACGCCTGTCGAGCAACAAGAACGCGTGACTGCGTTTGAGACCTACGAGCGTGGTCG
AATCGCTCACGGCCGCGGGAGTTTGGCGGCCTCGATGGCCGCTCCCCAGGCAACCAGGCCTAAGCCGGTATGGCTGAAGGTCCCCGCGTTTGAGGGGAAG
GAAGGAGAGAACCTTCACTTCTGGGTCCGTGTGGTGGAGATCGCCATAAAGGCGGGTCTCATCTCGGACGAGCCAGTTCGGGTGGCGTTTGCCCTGTACA
ACCTTGGTGGACGTGCCAAGCACTGGGCATACACCAGGGAGACGACTTCTCCTTGATGCTTTGCATCCTGAGCTCAGCTGTGTGAGCAGCTTCAAACCGC
GTTCCTACCGGCGAACAATGTGTTCCGCCTGCACTCATGCTTTCTCGCGTGTAAGCAAGGTAAACGTGAGCTGCAGGAGTACGCGCAAGAGATGCGCACG
TTGGTGGCATCCCTGGCAGGGACTCCTCTGCCTGAAGACGTCAGCACAACAGTCTTCATGGACGGCCGGAAGGTCGGTCCTGCTCTCACCCAGCTATTCC
GGGTGCAAGCGACAACTATGGAGGAGGCGATTCGAATCGCCCTCCTAGAAGGGTACAGCCCCAAGCAGGCTGGTACTCCTCGGGAAGAGAAACATCGCCA
CGATGAGAATGGCGTTCCTCTGGAGGCGGAGCATCGCAGCAATGACGCTGTTGCTCCTGCTGTCACGCAGCTCGTTGATACTGATGCGCACAGCGAGCCC
GAACCCATGGACTTAAGATCAGCCAAGAGCTTGGTCCGCTGCTACGGATGCGGCGGACATGGACACTACCAGCGTGTGTGTCCCTCGCCAGACCTCAGGA
AGAGGACAGCCCGTGGACCCCAGGTCCAGTGGCGCAGGCCTCGGCCAGGTGGACGAAGACTCCCCGTCCACCAGTAGAGGCAGTATGCCCTACTGAAGAG
CGCTAAGCCTTCGTGATGGGTGTGCAGGCTGTGCGCACCACGGGACTTAGCCCAGAGAGACGTTGTTCTCTCAAACCGGTGAAGGGCAGTGATGGGCCGC
TGGTAGTGCACTCGCTGTACGGGGTACGATACCCCTTGAACGTTTGAAGGGTTCTAGGGCGTTGATACGCCGCCGGAACGTCGCTTGGCATAGCGACACC
GACTGCACTCTATGTCAGAGTGGCTGGTCCTTGGTGGACTAGCCTTTGGTACGGTGAAGGAAGTACCTTAACGGACCTGAACGTTTGGTTTGATGAACTC
GCGCACGGCGGTGTCGCTCGCAGTTTTCGCCATGCACAACATGGCTGTGCCGAACATAAAGCACAGTCCGGTCTTTGGTGTGGCAAGGCCGAGAAGGGCC
TACCAGTCCAGTGTATGACGGAGCATTAGTGAGTCATGTTCCCACCTCCGTCAGGTCTGGGACATCTGATATAGACCGCCAGGACGCAGAATCGCCACGG
GGTTGTCAACACCCCACGGCTCTGCGTACAGCAAGGCCATGCTCCGCTGCGGCAATGCCACGGGCGTGGCCCTTTTTGCCCGCCGTGTGGACCTGCTACA
CCAGCAGCGTCCAACGCCGAAGGTCGTCGCGCCGTACGGGCTTCGACAGTGGTTACGCCTTTAAGCGCTAACCAGGTGGGTAACTTAGGACCACACGGTC
GCCCCGACCTTAACTGAAGAGGAAGGCGCTGAATGCGCTTCCTGTGTGGATAACACAGTACCCCCCGCTGACGCCCAGACTATATCTGAAGAGGAAGGCA
CTGATCATGCTTCCTGTGTGGGTAACACAGTACCACACGCAGTCGCCCAGACTATAACGGATGCGGAAGGCATTGTCCATGCTTCCTGTGTGAGTAACAC
AGTGCCACACGAGGTCTCAAGTGCCTCTGATGTCGTCAACGAGACATTACGACGTGGGTAACGAAGTGCCACGTCACGTTAACCGCCGCAAGTCGGGTCT
GAACCTTGTTCAGGCCGACGTGGTCTGAACCTTGTTCAGGCCGACGTCGGTTCAAGCGACTCGGAGTCCAGAGCCCAGACTCCTCTGACTCGGTCGCTGG
ACACCAACTCTGTCCGGTGTGTGTGCGGGTCTGCCACGTCAGCTGATCCCAACACTGAAGGTCGCCGCGCCG